IGEM:Stanford/2009/Project Homeostasis/Primer

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Anti-Immunosuppression Device)
(Anti-Inflammatory Device)
Line 219: Line 219:
GAATTAAGTCATGGCTATAGCATTTGGGCGTGCATAACAAAATTGGTCCTCATATTTTAGAGTATGATTG
GAATTAAGTCATGGCTATAGCATTTGGGCGTGCATAACAAAATTGGTCCTCATATTTTAGAGTATGATTG
CATATTCACTAATATTTTTACTTTCTGATGCGTGGTGGCATCATGCTTTATGAGATAAACAATCCTGG
CATATTCACTAATATTTTTACTTTCTGATGCGTGGTGGCATCATGCTTTATGAGATAAACAATCCTGG
 +
 +
blh
 +
 +
ATGGGTCTGATGCTGATTGATTGGTGTGCACTGGCTCTGGTTGTTTTCATTGGCCTGCCGCACGGCGCG
 +
CTGGATGCTGCCATTTCTTTTTCTATGATCTCTTCTGCAAAACGCATTGCTCGTCTGGCTGGTATTCTG
 +
CTGATCTATCTGCTGCTGGCGACCGCGTTCTTCCTGATCTGGTATCAGCTGCCAGCGTTTAGCCTGCTG
 +
ATCTTCCTGCTGATCTCCATTATCCACTTTGGTATGGCAGACTTCAACGCGTCCCCAAGCAAACTGAAA
 +
TGGCCGCATATCATCGCCCACGGCGGTGTTGTTACTGTTTGGCTGCCGCTGATCCAGAAAAACGAAGTA
 +
ACTAAACTGTTTAGCATCCTGACTAACGGTCCGACTCCGATCCTGTGGGACATCCTGCTGATTTTCTTC
 +
CTGTGTTGGTCTATTGGCGTGTGTCTGCACACGTACGAAACCCTGCGCTCTAAACATTACAACATCGCC
 +
TTTGAACTGATCGGTCTGATTTTCCTGGCGTGGTATGCGCCGCCTCTGGTTACGTTTGCCACTTACTTC
 +
TGCTTCATTCATTCCCGTCGCCACTTCTCCTTTGTGTGGAAGCAGCTGCAACACATGTCTTCCAAAAAG
 +
ATGATGATTGGCAGCGCGATTATCCTGTCCTGTACCTCTTGGCTGATCGGCGGTGGTATCTATTTCTTC
 +
CTGAACTCCAAAATGATCGCCTCTGAGGCTGCGCTACAAACTGTGTTCATCGGTCTGGCGGCACTGACC
 +
GTGCCGCACATGATTCTGATCGACTTCATCTTCCGTCCGCACTCTTCCCGTATCAAAATCAAAAACTGA
 +
 +
 +
 +
RALDH II
 +
 +
ATGCCCGGCGAGGTGAAGGCCGACCCCGCCGCGCTCATGGCCTCGCTTCAGCTCCTGCCGTCACCCACGCCCAACCTCGAGATCAAGTACACCAAGATCTTTATTAACAATGAATGGCAGAACTCAGAGAGTGGGAGAGTGTTCCCTGTCTGTAATCCAGCCACAGGAGAGCAAGTGTGTGAAGTTCAAGAAGCAGACAAGGTGGATATAGACAAGGCAGTGCAGGCGGCCCGCCTGGCCTTCTCTCTTGGTTCTGTGTGGAGAAGGATGGACGCTTCTGAAAGAGGACGTCTGCTGGACAAGCTTGCAGACTTGGTGGAACGGGACAGGGCAACTCTTGCAACTATGGAATCACTAAATGGCGGTAAGCCATTCCTGCAAGCTTTTTACATCGATTTGCAGGGAGTCATCAAAACCCTGAGGTATTATGCAGGCTGGGCTGATAAAATTCACGGAATGACCATTCCTGTAGATGGAGACTATTTTACCTTCACGAGACATGAGCCCATCGGAGTGTGTGGACAGATTATCCCGTGGAATTTCCCCCTGCTGATGTTCACCTGGAAAATTGCTCCCGCACTGTGCTGTGGTAACACTGTGGTCATCAAGCCAGCAGAGCAGACACCACTCAGTGCACTGTATATGGGAGCCCTCATCAAGGAGGCTGGCTTTCCACCCGGGGTCGTCAACATTCTGCCAGGGTATGGGCCAACAGCAGGGGCAGCAATAGCGTCTCACATTGGCATAGACAAGATTGCATTCACAGGCTCTACTGAGGTTGGAAAGCTTATTCAAGAAGCAGCTGGAAGAAGTAATTTGAAGAGAGTAACTCTGGAACTTGGAGGGAAAAGCCCTAATATTATTTTTGCAGATGCTGACTTGGACTACGCTGTGGAGCAGGCTCACCAGGGTGTGTTCTTCAACCAAGGCCAGTGCTGCACTGCGGGGTCTCGAATCTTTGTGGAGGAGTCCATCTATGAGGAATTTGTGAAAAGAAGTGTGGAAAGAGCCAAGAGGCGCATTGTGGGGAGCCCCTTTGATCCCACTACTGAGCAGGGTCCTCAGATTGATAAGAAGCAATACAACAAAATCCTGGAGCTCATCCAGAGCGGTGTGGCCGAGGGCGCCAAGCTCGAGTGTGGAGGCAAAGGACTGGGAAGGAAGGGCTTCTTCATTGAGCCTACCGTGTTCTCCAACGTTACAGATGACATGCGGATCGCCAAGGAGGAGATCTTTGGTCCTGTCCAGGAAATTTTGAGGTTTAAGACTATGGATGAAGTTATAGAAAGAGCCAATAACTCAGACTTCGGGCTTGTAGCGGCTGTCTTCACTAATGACATCAACAAGGCTCTCATGGTGTCCTCTGCAATGCAAGCTGGGACAGTTTGGATCAATTGTTACAACGCCTTAAATGCTCAGAGCCCCTTCGGGGGGTTCAAGATGTCTGGAAATGGGAGAGAAATGGGTGAGTTTGGCTTACGGGAGTACTCAGAAGTAAAGACCGTGACGGTGAAGATCCCCCAGAAGAACTCCTAA
==Comments==
==Comments==
*For gene sequencing, I would suggest genedesigner
*For gene sequencing, I would suggest genedesigner
*For primer design and selection I would suggest APE and oligo 6.87
*For primer design and selection I would suggest APE and oligo 6.87

Revision as of 12:53, 6 July 2009

Anti-Immunosuppression Device

Primers


[OPTIONAL]: Primers to use GTT TCT TC instead of TATA in front? I.e.

GTTTCTTCgaattcgcggccgcttctagATGGTTTGCTTTTTTTTACCTGCCA

Instead of:

TATA gaattcgcggccgcttctagATGGTTTGCTTTTTTTTACCTGCCA



  • HlyC (from E. coli str. CFT073)

Forward: TATAgaattcgcggccgcttctagagTTGGTTTGCTTTTTTTTACCTGCC

Reverse: TATA tactagtagcggccgctgcagTTAACCTGTTAATGAAAAATTGAAATC

untire sequence: http://www.ncbi.nlm.nih.gov/nuccore/NC_004431.1/?from=3418210&to=3418884&report=fasta



Added 7/1/09 - Mark

  • HlyB (from E. coli str. CFT073)

Forward: TATAgaattcgcggccgcttctagagGGAGTCATAATGGATTCTTGTC

Reverse: TATAtactagtagcggccgctgcagGTTAGTCTGACTGTAACTG


  • HlyD (from E. coli str. CFT073)

Forward: TATAgaattcgcggccgcttctagATGAAAACATGGTTAATGGGGTTCAGCG

Reverse: TATAtactagtagcggccgctgcagCTCTGAGACTTAACGCTCATG


  • TolC (from E. coli str. CFT073)

Forward: TATAgaattcgcggccgcttctagagGCAAATGAAGAAATTGCTCC

Reverse: TATAtactagtagcggccgctgcagCGTCATCAGTTACGGAAAGGG


Added 7/1/09 - Ming

  • HlyB (from CFT073)

"Forward": TATAgaattcgcggccgcttctag ATGGATTCTTGTCATAAAATTG

"Reverse": TATAtactagtagcggccgctgcag TTAGTCTGACTGTAACTG


  • HlyD (from CFT073)

"Forward":TATA gaattcgcggccgcttctag ATGAAAACATGGTTAATG

"Reverse": TATAtactagtagcggccgctgcag TTAACGCTCATGTAAACTTTC


  • TolC

"Forward": TATAgaattcgcggccgcttctagATGAAGAAATTGCTCCCCATTC

"Reverse": TATAtactagtagcggccgctgcagTCAGTTACGGAAAGGGTTATG'

  • HlyA

complete genome: [1]


Added 6/28/09 - Robert, Ariana

  • IL-6 fusion gene

"Forward": TATAGAATTCGCGGCCGCTTCTAGAGGGATGCATCACCGGTTCCGC

"Reverse": ATATTACTAGTAGCGGCCGCTGCAGGGATGCATTCATTTGACGAAGAG


Added 7/1/09 - Anusuya

  • TrpR (E. coli str. IAI1)

Forward: TATAgaattcgcggccgcttctagATGGCCCAACAATCACCCTATTCAGC

Reverse: 'TATAtactagtagcggccgctgcagTCAATCGCTTTTCAGCAACACCTCTTCCAGCCACTGGC


  • Trp Promoter and Operator (E. coli: no specified strain )

Forward: TATAgaattcgcggccgcttctagagCTCAAGGCGCACTCCCGTTCTG

Reverse: TATAtactagtagcggccgctgcagTCGATACCCTTTTTACGTGAACTTGCGTACTAG


  • Protease-binding sequence?


Gene Sequences


  • HylB

ATGATCATCAATAAATTTTCCCTTAAATGGATGTTGGCTATTGCCGTCGCCATCCCTGCGATAGCACTGTTGTTTGTGGCTTTCACCAGTCTAAACACCATGTCAGTGATGCAAGCGCAGTCCAACAGCTTGTATGCCAACACGGCTGCACCAATGCGTGCCATGGCTGAAGCAACCTCACGTATTCCTCGGATGCGTGTCGGTATCGATATGATGCTACTGCAAGAAACGGCGCTCAAAGATGCGAAAGGGGTCCTCAAACGAGTCGAAGAGGCAAGAACCGAAGATATCCCAGAAATGCGTCAAGCAATGCAAGTTGCGGTTGATTCTCAGGTTAATCCGGAACTCAAAGAGCAGGCACGCAAACTTCAAGCTCGTTTTGAACAAATGGTACGTGAAGAGTTAGAGCCTATGCTGCAAGCCTTCGCCAATAACGATATGACCACGGCACAAAACATTTACCGCGATAAATACGCGCCGACCTATGGTGAAATGCGTAAACAAGCCAACCAGATCCTCGATACGCTTTTGCAGCAAGCGGAGCAGCAAAACCATGCCAGTGTGGAAAGCTTCGAAGCAGGACGCACCAAGCAAATGGTGATCATTGCAGCAGGCTTGATCATTTCATTCATCACTTCACTGGTTATCATAACGAACTTACGTAGCCGAGTGGCTTACCTGAAAGATCGTATGAGTTCTGCGGCGGCGAATCTTTCACTGCGTACTCGATTGGAGTTGGATGGTAACGATGAACTGTGTGACATCGGTAAAAGCTTCAATGCGTTCATTGATAAAGTGCATCACTCGATTGAAGAAGTGGCAGAAAACTCAAAAGAGCTGGCGACGATGGCCTCTAGTGTGTCGCAGCGCGCGCACATGACGCAATCTAACTGTGCTTCGCAGCGAGATAGAACAGTGCAAGTTGCGACGGCGATTCATGAGCTTGGTGCCACCGTATCCGAAATCGCTTCCAATGCGGCCATGGCTGCCGATGTCGCGAAGCAAGCGACGCTGCATTCTGGTGAAGGGAAAAAAGTGGTAGGCGAAGTGCAAAATCGGATCCAAACACTGGTCAATGAACTCGATAATGCCACTCAAGTTGTCTCATCACTGGCGACCCAAATTAACGGTATTAGCTCAACACTTGATACCATTCGCAGTATTTCTGAGCAAACGAACCTATTGGCGCTCAACGCTGCGATTGAAGCTGCGCGAGCGGGTGAACAAGGTCGTGGTTTTGCGGTGGTGGCGGATGAAGTTCGCACATTAGCAAGTCGTTCAGCGGCATCGACGGAAGAGATCCAGCAAGTCATTAATCGCCTTCAAACGGAGTCAACTCGCGCAGTAGAAGCAATGGAAAAAGGTCGCTCGCAAAGTGATGTGGTGGTTGAGTTTTCCGCTAAAGCGAACCAATCTCTCACAGAGATCAACAGCCAAATTGATCAGATTAATGATCAAAATATTCAAGTTGCGACCGCGACAGAGGAACAATCAACCGTGGTGGAAGACATTAATCGCAACGTTGAAGACATCAACCAACTGACGACAGAAACCTCGCATGTTGCGGATGAGTTAAGCCGAGCCAGTGCAAGCTTGCAACGTCTCTCTTCGCAACTGGATAAACTGGTGGGCAGTTTTGAACTTTAA http://www.ncbi.nlm.nih.gov/nuccore/NC_012583.1/?from=274978&to=276624&report=fasta NCBI Reference Sequence: NC_012583.1 from Vibrio cholerae O395 chromosome II, complete genome

  • HylD

ATGGCTGCGTTCGGACAAGACGTCTTCAGGCGCTTCGGCACGGTCACCGAACGCTTCTCCGGCACCGGCGGCAAACTCTTCGGCGGCCTGCTCGCGCGCCTGTCGAGCGTGGAGCGCGACGACAGCCTGGACTGGGCGAGCGACGCCGACTGGGCGCGCCTGCAGCAGGAGCCGCTGCGCGCGCGCGCGGTACTCAAGGTCAGCGCGATCGCGCTGCTGGTGCTGCTCGGCTGGGCCGCGGTGGCGCATGTGGACGAGGTGACCAAGGGCGACGGCAAGGTGATCCCGTCCAGCCAGCTGCAGATCATCCAGTCGGTCGATGGCGGCGTGGTGGAGTCGATCGCGGTGCGCGAGGGCGAGGTGGTCGAGGCCGGGCAGCTGCTGCTCAAGGTCGATCCCACCCGTTTCATGTCCTCGCTGCTGGAAAACCGCGCCGAGTTCCTCGCGCTGGAAATCAAGCGCCGGCGGCTCGAGGCGCTGACCCAGGGGACGCCGTTCTCGGTGCCGGCCGAGCTGGAGAAGGAGGCGGCGGACATCGCCGCCCACGAGCGCCGGCTGTATGAATCCAGCCGCGCCGAGATGGACGCGCAGCAGTCGATCGCGCGCGACCAGCTGCGCCAGCGCGAGCAGGAACTCAACGAGGTGCGCGCCCGCAGTGAGAACGCCGCCCGCGCCTACGAACTGGTGCAGCAGGAACTCAAGGTCACCAAGCCGCTCGCGGCCTCCGGCGCGGTATCCGAGGTCGAGCTGCTGCGTCTGGAGCGCGACGTGTCGCGCTTGCGCGGCGAGCGCGAGCAGAGCGCGGCGCAGATTTCGCGCATCCAGTCGGCCATCGCCGAATCCACGCGCAAGATCCAGGAGATCGAGCTGACGGTGCGCAACCAGCTGCGCAACGAGCTTTCGGACACCATGGCGCGGCTGGGCAGCCTGACCCAGGGCAGCCGCATGCTGGCCGACCGCGTCAAGCACGCCGAAATCCGCGCGCCGATGCGCGGCACGGTCAAGCGCATCCTCGTCAACACCGTGGGTGGCGTGGTCCAGCCGGGCAAGGAAGTGGCCGAGATCGTGCCGCTCGACGACGCGCTGATCCTCGAAGCGCAGGTCAAGCCGAGCGACATCGCCTTCCTGCGCCCGGGTCAGTCGGCGCTGGTCAAGTTCTCCGCGTACGACTTCTCGATCTACGGCGGCCTGGAGGCGGTCGTGGACCAGATTTCCGCCGACACCGTGGTCGATGCAAAGGGTTCCGCGTTCTACGTGGTGCGGGTGCGCACGCTGCATTCCTCTCTGGGTGAAAACCTGCCGATCATTCCGGGCATGGTGGCCGAAGTGGACATCCTGACCGGCAAGAAGACCATCCTCTCCTACCTGCTGAAGCCCGTGCTGCGGGCCAAGGCCAACGCACTGTCCGAACGATGA http://www.ncbi.nlm.nih.gov/nuccore/NC_008702.1/?from=674498&to=675913&report=fasta NCBI Reference Sequence: NC_008702.1 from Azoarcus sp. BH72, complete genome

  • TolC

ATGAAGAAATTGCTCCCCATTCTTATCGGCCTGAGCCTTTCTGGGTTCAGTTCGTTGAGCCAGGCCGAGAACCTGATGCAAGTTTATCAGCAAGCACGCCTTAGTAACCCGGAATTGCGTAAGTCTGCCGCCGATCGTGATGCTGCCTTTGAAAAAATTAATGAAGCGCGCAGTCCATTACTGCCACAGCTAGGTTTAGGTGCAGATTACACCTATAGCAACGGCTACCGCGACGCGAACGGCATCAACTCTAACGCGACCAGTGCGTCCTTGCAGTTAACTCAATCCATTTTTGATATGTCGAAATGGCGTGCGTTAACGCTGCAGGAAAAAGCAGCAGGGATTCAGGACGTCACGTATCAGACCGATCAGCAAACCTTGATCCTCAACACCGCGACCGCTTATTTCAACGTGTTGAATGCTATTGACGTTCTTTCCTATACACAGGCACAAAAAGAAGCGATCTACCGTCAATTAGATCAAACCACCCAACGTTTTAACGTGGGCCTGGTAGCGATCACCGACGTGCAGAACGCCCGCGCACAGTACGATACCGTGCTGGCGAACGAAGTGACCGCACGTAATAACCTTGATAACGCGGTAGAGCAGCTGCGCCAGATCACCGGTAACTACTATCCGGAACTGGCTGCGCTGAATGTCGAAAACTTTAAAACCGACAAACCACAGCCGGTTAACGCGCTGCTGAAAGAAGCCGAAAAACGCAACCTGTCGCTGTTACAGGCACGCTTGAGCCAGGACCTGGCGCGCGAGCAAATTCGCCAGGCGCAGGATGGTCACTTACCGACTCTGGATTTAACGGCTTCTACCGGGATTTCTGACACCTCTTATAGCGGTTCGAAAACCCGTGGTGCCGCTGGTACCCAGTATGACGATAGCAATATGGGCCAGAACAAAGTTGGCCTGAGCTTCTCGCTGCCGATTTATCAGGGCGGAATGGTTAACTCGCAGGTGAAACAGGCACAGTACAACTTTGTCGGTGCCAGCGAGCAACTGGAAAGTGCCCATCGTAGCGTCGTGCAGACCGTGCGTTCCTCCTTCAACAACATTAATGCATCTATCAGTAGCATTAACGCCTACAAACAAGCCGTAGTTTCCGCTCAAAGCTCATTAGACGCGATGGAAGCGGGCTACTCGGTCGGTACGCGTACCATTGTTGATGTGTTGGATGCGACCACCACGTTGTACAACGCCAAGCAAGAGCTGGCGAATGCGCGTTATAACTACCTGATTAATCAGCTGAATATTAAGTCAGCTCTGGGTACGTTGAACGAGCAGGATCTGCTGGCACTGAACAATGCGCTGAGCAAACCGGTTTCCACTAATCCGGAAAACGTTGCACCGCAAACGCCGGAACAGAATGCTATTGCTGATGGTTATGCGCCTGATAGCCCGGCACCAGTCGTTCAGCAAACATCCGCACGCACTACCACCAGTAACGGTCATAACCCTTTCCGTAACTGA http://www.ncbi.nlm.nih.gov/nuccore/NC_000913.2/?from=3176137&to=3177618&report=fasta NCBI Reference Sequence: NC_000913.2 from Escherichia coli str. K-12 substr. MG1655, complete genome


  • IL-6 fusion gene


  • Protease-binding sequence?

Anti-Inflammatory Device

Primers:


SoxR (Escherichia coli E24377A)

Forward: TATAgaattcgcggccgcttctagATGGAAAAGAAATTACCCCGC

Reverse: TATAtactagtagcggccgctgcagTTAGTTTTGTTCATCTTCCAGCAAGCGTG

complete gene sequence: [2]


Added 7/1/09 - Anusuya

CrtB (Erwinia Uredovora)

Forward: TATAgaattcgcggccgcttctagATGGCAGTTGGCTCGAAAAG

Reverse: TATAtactagtagcggccgctgcagCTAGAGCGGGCGCTGCCAG


CrtE (Erwinia Uredovora)

Forward: TATAgaattcgcggccgcttctagATGACGGTCTGCGCAAAAAAAC

Reverse: TATAtactagtagcggccgctgcagTTAACTGACGGCAGCGAGTTTTTTG


CrtI (Erwinia Uredovora)

Forward: TATAgaattcgcggccgcttctag ATGAAACCAACTACGGTAATTGGTGC

Reverse: TATAtactagtagcggccgctgcag TGATTGAGTAACGACGG


CrtY (Erwinia Uredovora)

Forward: TATAgaattcgcggccgcttctag ATGCAACCGCATTATGATCTG

Reverse: TATAtactagtagcggccgctgcag TTAACGATGAGTCGTCATAATGGC


Soxs: primer dimers


Blh (Halobacterium sp. NRC1)

Forward: TATAgaattcgcggccgcttctagATGCCACACGGCGCGATCG

Reverse: TATAtactagtagcggccgctgcagTCAGAGGACGCCCTGCAC


RalDH(II) (Don't think it's Rattus Norvegicus)

Forward: TATAgaattcgcggccgcttctagATGCCCGGCGAGGTGAAGGC

Reverse: TATAtactagtagcggccgctgcagTTAGGAGTTCTTCTGGGGGATC

HlyR: Since HlyR is not a protein. This sequence is sequenced as a chunk with HlyA,HlyB, HlyC. Thus only one primer is needed. primer: TATAtactagtagcggccgctgcagGAATTCCAAGCGAAGTCC

check paper for RalDH(II) http://www.jbc.org/cgi/content/abstract/271/27/16288

Gene sequences: SoxR ATGGAAAAGAAATTACCCCGCATTAAAGCGCTGCTAACCCCCGGCGAAGTGGCGAAACGCAGCGGTGTGGCGGTATCGGCGCTGCATTTCTATGAAAGTAAAGGGTTGATTACCAGTATCCGTAACAGCGGCAATCAGCGGCGATATAAACGTGATGTGTTGCGATATGTTGCAATTATCAAAATTGCTCAGCGTATTGGCATTCCGCTGGCGACCATTGGTGAAGCGTTTGGCGTGTTGCCCGAAGGGCATACGTTAAGTGCGAAAGAGTGGAAACAGCTTTCGTCCCAATGGCGAGAAGAGTTGGATCGGCGCATTCATACCTTAGTGGCGCTGCGTGACGAACTGGACGGATGTATTGGTTGTGGCTGCCTTTCGCGCAGTGATTGCCCGTTGCGTAACCCGGGCGACCGCTTAGGAGAAGAAGGTACCGGCGCACGCTTGCTGGAAGATGAACAAAACTAA http://www.ncbi.nlm.nih.gov/nuccore/NC_009801.1/?from=4616553&to=4617017&report=fasta (NCBI Reference Sequence: NC_009801.1 from Escherichia coli E24377A, complete genome)

Crt genes GenBank accession no. D90087—should we do as the entire cluster (in this case how should we design primers) or in parts?

Blh ATGGGTCTGATGCTGATTGATTGGTGTGCACTGGCTCTGGTTGTTTTCATTGGCCTGCCGCACGGCGCGCTGGATGCTGCCATTTCTTTTTCTATGATCTCTTCTGCAAAACGCATTGCTCGTCTGGCTGGTATTCTGCTGATCTATCTGCTGCTGGCGACCGCGTTCTTCCTGATCTGGTATCAGCTGCCAGCGTTTAGCCTGCTGATCTTCCTGCTGATCTCCATTATCCACTTTGGTATGGCAGACTTCAACGCGTCCCCAAGCAAACTGAAATGGCCGCATATCATCGCCCACGGCGGTGTTGTTACTGTTTGGCTGCCGCTGATCCAGAAAAACGAAGTAACTAAACTGTTTAGCATCCTGACTAACGGTCCGACTCCGATCCTGTGGGACATCCTGCTGATTTTCTTCCTGTGTTGGTCTATTGGCGTGTGTCTGCACACGTACGAAACCCTGCGCTCTAAACATTACAACATCGCCTTTGAACTGATCGGTCTGATTTTCCTGGCGTGGTATGCGCCGCCTCTGGTTACGTTTGCCACTTACTTCTGCTTCATTCATTCCCGTCGCCACTTCTCCTTTGTGTGGAAGCAGCTGCAACACATGTCTTCCAAAAAGATGATGATTGGCAGCGCGATTATCCTGTCCTGTACCTCTTGGCTGATCGGCGGTGGTATCTATTTCTTCCTGAACTCCAAAATGATCGCCTCTGAGGCTGCGCTGCAGACTGTGTTCATCGGTCTGGCGGCACTGACCGTGCCGCACATGATTCTGATCGACTTCATCTTCCGTCCGCACTCTTCCCGTATCAAAATCAAAAACTGA

Kim et al. In vitro characterization of a recombinant Blh protein from an uncultured marine bacterium as a beta-carotene 15,15'-dioxygenase. J Biol Chem. 2009 Jun 5;284(23):15781-93. (supplementary material; 15,15'-Dioxygenase, product of Blh gene, codon-optimized and expressed in E. coli, forms a 64k protein of two 32 kDa dimers)

RALDH?


HlyR:

sequence: GAATTCCAAGCGAAGTCCATCCCCCTCCCTCTTGATTACAAGGGTGATAATTATTATTCGCATTTGTGTG GTAATGGGATAGAAAGGAATGGATAGAAAAAGAACAAAATTAGTATAGCAATAGATATGCCCACTGCATT GAATACTTACAGGGCATTATTTTATTATGTTTAAATTGAAGTGGTCTCTGGTTTGATTTATTTGTTATTC AAGGGGGCTGTTTGGAGATCGGAAAATTCTGTACGTTAAGTGTATTATTTAACCAGTTTCGATGCGTAAC AGATTGATTTTGCTCAGCGGTTATCGCTTTTAAGTTGTTGCTCTTGGCTATCGCGTTTAGGTTATCCGAT TAAAGTCAAATTTCCTGAAAATGCTGTATAGCGCGGGAGTGCACCTTATAGCTGTAGGTAAGTATGTTCA AAAAATAGTCTTGCCGTACAATAATTTTCCATATCCAAACTCACTCCTTCAAGATTCTGGTCCCGGTTTA CGGGTAGTTTCCGGAAGGGCGGTAGCATGCTGATTCAAACTGCAAGATGAAACATTGTCGGAGTTGGATG GAATTAAGTCATGGCTATAGCATTTGGGCGTGCATAACAAAATTGGTCCTCATATTTTAGAGTATGATTG CATATTCACTAATATTTTTACTTTCTGATGCGTGGTGGCATCATGCTTTATGAGATAAACAATCCTGG

blh

ATGGGTCTGATGCTGATTGATTGGTGTGCACTGGCTCTGGTTGTTTTCATTGGCCTGCCGCACGGCGCG CTGGATGCTGCCATTTCTTTTTCTATGATCTCTTCTGCAAAACGCATTGCTCGTCTGGCTGGTATTCTG CTGATCTATCTGCTGCTGGCGACCGCGTTCTTCCTGATCTGGTATCAGCTGCCAGCGTTTAGCCTGCTG ATCTTCCTGCTGATCTCCATTATCCACTTTGGTATGGCAGACTTCAACGCGTCCCCAAGCAAACTGAAA TGGCCGCATATCATCGCCCACGGCGGTGTTGTTACTGTTTGGCTGCCGCTGATCCAGAAAAACGAAGTA ACTAAACTGTTTAGCATCCTGACTAACGGTCCGACTCCGATCCTGTGGGACATCCTGCTGATTTTCTTC CTGTGTTGGTCTATTGGCGTGTGTCTGCACACGTACGAAACCCTGCGCTCTAAACATTACAACATCGCC TTTGAACTGATCGGTCTGATTTTCCTGGCGTGGTATGCGCCGCCTCTGGTTACGTTTGCCACTTACTTC TGCTTCATTCATTCCCGTCGCCACTTCTCCTTTGTGTGGAAGCAGCTGCAACACATGTCTTCCAAAAAG ATGATGATTGGCAGCGCGATTATCCTGTCCTGTACCTCTTGGCTGATCGGCGGTGGTATCTATTTCTTC CTGAACTCCAAAATGATCGCCTCTGAGGCTGCGCTACAAACTGTGTTCATCGGTCTGGCGGCACTGACC GTGCCGCACATGATTCTGATCGACTTCATCTTCCGTCCGCACTCTTCCCGTATCAAAATCAAAAACTGA


RALDH II

ATGCCCGGCGAGGTGAAGGCCGACCCCGCCGCGCTCATGGCCTCGCTTCAGCTCCTGCCGTCACCCACGCCCAACCTCGAGATCAAGTACACCAAGATCTTTATTAACAATGAATGGCAGAACTCAGAGAGTGGGAGAGTGTTCCCTGTCTGTAATCCAGCCACAGGAGAGCAAGTGTGTGAAGTTCAAGAAGCAGACAAGGTGGATATAGACAAGGCAGTGCAGGCGGCCCGCCTGGCCTTCTCTCTTGGTTCTGTGTGGAGAAGGATGGACGCTTCTGAAAGAGGACGTCTGCTGGACAAGCTTGCAGACTTGGTGGAACGGGACAGGGCAACTCTTGCAACTATGGAATCACTAAATGGCGGTAAGCCATTCCTGCAAGCTTTTTACATCGATTTGCAGGGAGTCATCAAAACCCTGAGGTATTATGCAGGCTGGGCTGATAAAATTCACGGAATGACCATTCCTGTAGATGGAGACTATTTTACCTTCACGAGACATGAGCCCATCGGAGTGTGTGGACAGATTATCCCGTGGAATTTCCCCCTGCTGATGTTCACCTGGAAAATTGCTCCCGCACTGTGCTGTGGTAACACTGTGGTCATCAAGCCAGCAGAGCAGACACCACTCAGTGCACTGTATATGGGAGCCCTCATCAAGGAGGCTGGCTTTCCACCCGGGGTCGTCAACATTCTGCCAGGGTATGGGCCAACAGCAGGGGCAGCAATAGCGTCTCACATTGGCATAGACAAGATTGCATTCACAGGCTCTACTGAGGTTGGAAAGCTTATTCAAGAAGCAGCTGGAAGAAGTAATTTGAAGAGAGTAACTCTGGAACTTGGAGGGAAAAGCCCTAATATTATTTTTGCAGATGCTGACTTGGACTACGCTGTGGAGCAGGCTCACCAGGGTGTGTTCTTCAACCAAGGCCAGTGCTGCACTGCGGGGTCTCGAATCTTTGTGGAGGAGTCCATCTATGAGGAATTTGTGAAAAGAAGTGTGGAAAGAGCCAAGAGGCGCATTGTGGGGAGCCCCTTTGATCCCACTACTGAGCAGGGTCCTCAGATTGATAAGAAGCAATACAACAAAATCCTGGAGCTCATCCAGAGCGGTGTGGCCGAGGGCGCCAAGCTCGAGTGTGGAGGCAAAGGACTGGGAAGGAAGGGCTTCTTCATTGAGCCTACCGTGTTCTCCAACGTTACAGATGACATGCGGATCGCCAAGGAGGAGATCTTTGGTCCTGTCCAGGAAATTTTGAGGTTTAAGACTATGGATGAAGTTATAGAAAGAGCCAATAACTCAGACTTCGGGCTTGTAGCGGCTGTCTTCACTAATGACATCAACAAGGCTCTCATGGTGTCCTCTGCAATGCAAGCTGGGACAGTTTGGATCAATTGTTACAACGCCTTAAATGCTCAGAGCCCCTTCGGGGGGTTCAAGATGTCTGGAAATGGGAGAGAAATGGGTGAGTTTGGCTTACGGGAGTACTCAGAAGTAAAGACCGTGACGGTGAAGATCCCCCAGAAGAACTCCTAA

Comments

  • For gene sequencing, I would suggest genedesigner
  • For primer design and selection I would suggest APE and oligo 6.87
Personal tools