IGEM:Stanford/2009/Project Homeostasis/Primer

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Anti-Immunosuppression Device)
(Anti-Inflammatory Device)
Line 219: Line 219:
*For gene sequencing, I would suggest genedesigner
*For gene sequencing, I would suggest genedesigner
*For primer design and selection I would suggest APE and oligo 6.87
*For primer design and selection I would suggest APE and oligo 6.87

Revision as of 11:53, 6 July 2009

Anti-Immunosuppression Device


[OPTIONAL]: Primers to use GTT TCT TC instead of TATA in front? I.e.


Instead of:


  • HlyC (from E. coli str. CFT073)

Forward: TATAgaattcgcggccgcttctagagTTGGTTTGCTTTTTTTTACCTGCC


untire sequence: http://www.ncbi.nlm.nih.gov/nuccore/NC_004431.1/?from=3418210&to=3418884&report=fasta

Added 7/1/09 - Mark

  • HlyB (from E. coli str. CFT073)

Forward: TATAgaattcgcggccgcttctagagGGAGTCATAATGGATTCTTGTC

Reverse: TATAtactagtagcggccgctgcagGTTAGTCTGACTGTAACTG

  • HlyD (from E. coli str. CFT073)


Reverse: TATAtactagtagcggccgctgcagCTCTGAGACTTAACGCTCATG

  • TolC (from E. coli str. CFT073)

Forward: TATAgaattcgcggccgcttctagagGCAAATGAAGAAATTGCTCC

Reverse: TATAtactagtagcggccgctgcagCGTCATCAGTTACGGAAAGGG

Added 7/1/09 - Ming

  • HlyB (from CFT073)

"Forward": TATAgaattcgcggccgcttctag ATGGATTCTTGTCATAAAATTG

"Reverse": TATAtactagtagcggccgctgcag TTAGTCTGACTGTAACTG

  • HlyD (from CFT073)

"Forward":TATA gaattcgcggccgcttctag ATGAAAACATGGTTAATG

"Reverse": TATAtactagtagcggccgctgcag TTAACGCTCATGTAAACTTTC

  • TolC

"Forward": TATAgaattcgcggccgcttctagATGAAGAAATTGCTCCCCATTC

"Reverse": TATAtactagtagcggccgctgcagTCAGTTACGGAAAGGGTTATG'

  • HlyA

complete genome: [1]

Added 6/28/09 - Robert, Ariana

  • IL-6 fusion gene



Added 7/1/09 - Anusuya

  • TrpR (E. coli str. IAI1)



  • Trp Promoter and Operator (E. coli: no specified strain )

Forward: TATAgaattcgcggccgcttctagagCTCAAGGCGCACTCCCGTTCTG


  • Protease-binding sequence?

Gene Sequences

  • HylB


  • HylD


  • TolC


  • IL-6 fusion gene

  • Protease-binding sequence?

Anti-Inflammatory Device


SoxR (Escherichia coli E24377A)

Forward: TATAgaattcgcggccgcttctagATGGAAAAGAAATTACCCCGC


complete gene sequence: [2]

Added 7/1/09 - Anusuya

CrtB (Erwinia Uredovora)

Forward: TATAgaattcgcggccgcttctagATGGCAGTTGGCTCGAAAAG

Reverse: TATAtactagtagcggccgctgcagCTAGAGCGGGCGCTGCCAG

CrtE (Erwinia Uredovora)

Forward: TATAgaattcgcggccgcttctagATGACGGTCTGCGCAAAAAAAC


CrtI (Erwinia Uredovora)


Reverse: TATAtactagtagcggccgctgcag TGATTGAGTAACGACGG

CrtY (Erwinia Uredovora)

Forward: TATAgaattcgcggccgcttctag ATGCAACCGCATTATGATCTG

Reverse: TATAtactagtagcggccgctgcag TTAACGATGAGTCGTCATAATGGC

Soxs: primer dimers

Blh (Halobacterium sp. NRC1)

Forward: TATAgaattcgcggccgcttctagATGCCACACGGCGCGATCG

Reverse: TATAtactagtagcggccgctgcagTCAGAGGACGCCCTGCAC

RalDH(II) (Don't think it's Rattus Norvegicus)

Forward: TATAgaattcgcggccgcttctagATGCCCGGCGAGGTGAAGGC

Reverse: TATAtactagtagcggccgctgcagTTAGGAGTTCTTCTGGGGGATC

HlyR: Since HlyR is not a protein. This sequence is sequenced as a chunk with HlyA,HlyB, HlyC. Thus only one primer is needed. primer: TATAtactagtagcggccgctgcagGAATTCCAAGCGAAGTCC

check paper for RalDH(II) http://www.jbc.org/cgi/content/abstract/271/27/16288


Crt genes GenBank accession no. D90087—should we do as the entire cluster (in this case how should we design primers) or in parts?


Kim et al. In vitro characterization of a recombinant Blh protein from an uncultured marine bacterium as a beta-carotene 15,15'-dioxygenase. J Biol Chem. 2009 Jun 5;284(23):15781-93. (supplementary material; 15,15'-Dioxygenase, product of Blh gene, codon-optimized and expressed in E. coli, forms a 64k protein of two 32 kDa dimers)









  • For gene sequencing, I would suggest genedesigner
  • For primer design and selection I would suggest APE and oligo 6.87
Personal tools