IGEM:UCSF/2007/Plasmids

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(New page: Expected sequences Below you have the sequences of the different parts in the right order, as well as the adaptor sequences between parts. You will need to arrange them accordingly to you...)
Line 101: Line 101:
AACTCTTTCCTGTGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTT
AACTCTTTCCTGTGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTT
ATTGACCACACCGAGCTC
ATTGACCACACCGAGCTC
 +
 +
 +
 +
 +
pFig1
 +
 +
TTGAATGATCAACCAAACGCCGATATAGTCACTATTGGTGATAAAATTAAAATGCAGCTATTGAGAACCCATCCTAACAACATTAAATTGTCTATTAATGGAATTGGTAAAGATGCCCCAACTTTCCAAGAATCTGCTTTGATTGCCGATAAGTTATTGAGTGTCATGAAGGCCGGCACTTACCCAAAGATTTCCATTTTCTACAATGACCCAGTGTCTTCCCTATCTTTTGAACCATCTGAAAAACCGATCTTTAACGCCAAGACCATTGAACAATCCCCATCATTCGGCAAATTTGAGATCGACACGGACGCAAACGTTCCAAGAGATTTGTTTGAATATACTTTGGCTAACCAAATGTTGACAGCAATGGCTCAAGGTTATGCTGCTGAAATTTCCGCCAGAAGAAACGCTATGGATAACGCTTCCAAGAATGCCGGTGATATGATCAATCGTTACTCTATCTTGTACAACAGAACAAGACAAGCTGTCATTACTAATGAACTGGTTGATATTATTACTGGTGCTTCCTCTTTGGGATGATAAAAAAATCACCCTGCATTGCCTCTTTATTTGACGTTGTTTTTGTAGAACATGAAACGAATTTTGACTTGATGAGACGAAGTATATATCCAAAGAATACCTTAAATAGAAAAGGAAAGATAATAAATACTAAACACTACTATATATTCAGGTAAAATACAAAAATTATAACATTTTTAAAACTTTTTTTTTTTGAAAGTCCTTCTCGCTTTAGGATTTTTTCCCATTAAGATTATGATGGTTTCATGTATGTGTCAGTTAAAAAAAATATGGCTAAGTAGCAATGAAACGAACCAAGAAAATGAAAACAATATATAGTGCTGTTGAAATAACAAAGACATTGGTATATATTTGTAAAATGTCTGTTAAATGTTTTTTATCTCAGGTTCTTGCTTGTCTTTGGTAGAAGAAATTATAGTAAACAAACAAACAAACAAACAAAAAAAAAAAAAAAAAA
 +
 +
pAdh
 +
 +
TTAAAACAAGAAGAGGGTTGACTACATCACGATGAGGGGGATCGAAGAAATGATGGTAAATGAAATAGGAAATCAAGGAGCATGAAGGCAAAAGACAAATATAAGGGTCGAACGAAAAATAAAGTGAAAAGTGTTGATATGATGTATTTGGCTTTGCGGCGCCGAAAAAACGAGTTTACGCAATTGCACAATCATGCTGACTCTGTGGCGGACCCGCGCTCTTGCCGGCCCGGCGATAACGCTGGGCGTGAGGCTGTGCCCGGCGGAGTTTTTTGCGCCTGCATTTTCCAAGGTTTACCCTGCGCTAAGGGGCGAGATTGGAGAAGCAATAAGAATGCCGGTTGGGGTTGCGATGATGACGACCACGACAACTGGTGTCATTATTTAAGTTGCCGAAAGAACCTGAGTGCATTTGCAACATGAGTATACTAGAAGAATGAGCCAAGACTTGCGAGACGCGAGTTTGCCGGTGGTGCGAACAATAGAGCGACCATGACCTTGAAGGTGAGACGCGCATAACCGCTAGAGTACTTTGAAGAGGAAACAGCAATAGGGTTGCTACCAGTATAAATAGACAGGTACATACAACACTGGAAATGGTTGTCTGTTTGAGTACGCTTTCAATTCATTTGGGTGTGCACTTTATTATGTTACAATATGGAAGGGAACTTTACACTTCTCCTATGCACATATATTAATTAAAGTCCAATGCTAGTAGAGAAGGGGGGTAACACCCCTCCGCGCTCTTTTCCGATTTTTTTCTAAACCGTGGAATATTTCGGATATCCTTTTGTTGTTTCCGGGTGTACAATATGGACTTCCTCTTTTCTGGCAACCAAACCCATACATCGGGATTCCTATAATACCTTCGTTGGTCTCCCTAACATGTAGGTGGCGGAGGGGAGATATACAATAGAACAGATACCAGACAAGACATAATGGGCTAAACAAGACTACACCAATTACACTGCCTCATTGATGGTGGTACATAACGAACTAATACTGTAGCCCTAGACTTGATAGCCATCATCATATCGAAGTTTCACTACCCTTTTTCCATTTGCCATCTATTGAAGTAATAATAGGCGCATGCAACTTCTTTTCTTTTTTTTTCTTTTCTCTCTCCCCCGTTGTTGTCTCACCATATCCGCAATGACAAAAAAATGATGGAAGACACTAAAGGAAAAAATTAACGACAAAGACAGCACCAACAGATGTCGTTGTTCCAGAGCTGATGAGGGGTATCTCGAAGCACACGAAACTTTTTCCTTCCTTCATTCACGCACACTACTCTCTAATGAGCAACGGTATACGGCCTTCCTTCCAGTTACTTGAATTTGAAATAAAAAAAAGTTTGCTGTCTTGCTATCAAGTATAAATAGACCTGCAATTATTAATCTTTTGTTTCCTCGTCATTGTTCTCGTTCCCTTTCTTCCTTGTTTCTTTTTCTGCACAATATTTCAAGCTATACCAAGCATACAATCAACTATCTCATATACA
 +
 +
 +
pCyc
 +
 +
cagatccgccaggcgtgtatatatagcgtggatggccaggcaactttagtgctgacacatacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctatagacacacaaacacaaatacacacactaaattaata
 +
 +
 +
pSte5
 +
 +
CACGAAGTGACTGACAGAATACTGACATCAGCTGATTTCTCATAGAGCTGTTTCTCTGATAACACGTTGTTTGAACATCGACAAGATGAAAATCTAGAAGTATCAAGTTTCCTTTAAAGGGATATATAACAGATTCTAAAACTGACAGAAATATTTCGAGTGAAGAAGAAGCGTTAAATATTGGATCTTTCCGCAGTTCTACTCTGATACATTTTTGAAGTAGGAGAGTCATTTAGAAGGCGTATTGCTCAATAGTAGAAAGCAGGCCTGTGCACATGAATTAATTAAAAAATATAAAGGTAGTGATTAGACGACACATGTCCATAGGTAACCTGTCATAATTTTGAACAATTTCCCTTCTTTTCTTTTTTTTTTTTGGGTGCGGCGATATGTAGCTTGTTAATTTACACATCATGTACTTTTCTGCATCAAAATATGAAAGGCGATAGTAGCTAAAGAAAATACCGAGAATTTCCTCGAAAAGTTGACGACAAAAGAAAGGCATAAAAAAGTAATTTGAAAATATTTTAAAACTGTTTTAACCCATCTAGCATCCGCGCTAAAAAAGGAAGATACAGGATACAGCGGAAACAACTTTTAA

Revision as of 14:31, 16 August 2007

Expected sequences

Below you have the sequences of the different parts in the right order, as well as the adaptor sequences between parts. You will need to arrange them accordingly to your particular constructs, so that you will have 1-2-3-4-5-6-7-8.

1-Promoter sequence (variable, depends on particular acceptor)

2-ATG-XhoI-“A” and 2 adaptor bases: ATGCTCGAGGGAGCT


3-mCherry:

GTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACG AGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCC CTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAG CTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGC AGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTG GGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCAC TACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCA CCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG

4-Adaptor bases, followed by “B” and another adaptor base: GGTAGTTCCCTA

5-Effectors

For YopH:

aacttatcattaagcgatcttcatcgtcaggtatctcgattggtgcagcaagagagcggtgattgtaccgggaaattaagaggtaacgt tgctgccaataaagaaactacctttcaaggtttgaccatagccagtggagccagagagtcagaaaaagtatttgctcaaactgtactaa gccacgtagcaaatgttgttctaactcaagaagataccgctaagctattgcaaagtacggtaaagcataatttgaataattatgactta agaagtgtcggcaatggtaatagtgtacttgtcagtttacgtagtgaccaaatgacactacaagacgccaaagtgctgttggaggccgc attgcgacaagagtcgggagcgagggggcatgtatcatctcattcacattcagcccttcacgcaccgggaaccccggtgcgtgaaggac tgcgttcacatctagaccccagaactccaccgttgccaccgcgtgaacgaccacacacttctggccatcacggggctggcgaagccaga gccaccgcaccaagcactgtttctccttatggcccagaagcgcgcgcagaactcagcagccgcctcaccacattgcgcaatacgctggc gccagcaacgaatgatccgcgttacttacaagcctgcggcggtgaaaagctaaaccgatttagagatattcaatgctgtcggcaaaccg cagtacgcgccgatcttaatgccaattacatccaggtcggtaacactcgtaccatagcgtgccagtatccgctacaatctcaacttgaa agccatttccgtatgctggcagaaaaccgaacgccagtgttggctgttttagcgtccagttctgagatagccaatcaaagattcggtat gccagattatttccgccagagtggtacctatggcagtatcactgtagagtctaaaatgactcagcaagttggtctcggtgacgggatta tggcagatatgtatactttaacgattcgtgaagcgggtcaaaaaacaatctctgttcctgtggttcatgttggcaattggcccgatcag accgcagtcagctctgaagttaccaaggcactcgcttcactggtagatcaaacagcagaaacaaaacgcaatatgtatgaaagcaaagg aagttcagcggtaggagatgactccaaattacggccggtaatacattgccgtgcgggtgttggccgtactgcgcaactgattggcgcaa tgtgcatgaatgatagtcgtaatagtcagttaagcgtagaagatatggtcagccaaatgcgagtacaaagaaatggtattatggtacaa aaagatgagcaacttgatgttctgattaagttggctgaaggacaagggcgaccattattaaatagc

For YopJ:

atcggaccaatatcacaaataaatatctccggtggcttatcagaaaaagagaccagttctttaatcagtaatgaagagcttaaaaatat cataacacagttggaaactgatatatcggatggatcctggttccataaaaattattcacgtatggatgtagaagtcatgcccgcattgg taatccaggcgaacaataaatatccggaaatgaatcttaatcttgttacatctccattggacctttcaatagaaataaaaaacgtcata gaaaatggagttagatcttcccgcttcataattaacatgggggaaggtggaatacatttcagtgtaattgattacaaacatataaatggg aaaacatctctgatattgtttgaaccagcaaactttaacagtatggggccagcgatgctggcaataaggacaaaaacggctattgaacgt tatcaattacctgattgccatttctccatggtggaaatggatattcagcgaagctcatctgaatgtggtatttttagtttggcactggca aaaaaactttacatcgagagagatagcctgttgaaaatacatgaagataatataaaaggtatattaagtgatggtgaaaatcctttaccc cacgataagttggacccgtatctcccggtaactttttacaaacatactcaaggtaaaaaacgtcttaatgaatatttaaatactaacccg cagggagttggtactgttgttaacaaaaaaaatgaaaccatcgttaatagatttgataacaataaatccattgtagatggaaaggaatta tcagtttcggtacataaaaagagaatagctgaatataaaacacttctcaaagta

For OspF:

CCAATTAAAAAGCCTTGTTTGAAATTGAATTTAGATTCTTTGAACGTTGTTAGATCAGAAATTCCACAAATGTTATCTGCTAATGAAAGAT TGAAAAATAATTTTAACATTTTATATAATCAAATAAGACAGTACCCAGCTTATTATTTTAAAGTTGCTTCTAATGTTCCTACTTACTCTGA TATATGTCAATTTTTCTCAGTTATGTATCAAGGTTTTCAGATAGTTAATCATTCTGGTGATGTTTTTATTCATGCTTGTAGAGAAAATCCA CAATCTAAAGGTGATTTTGTTGGTGACAAGTTCCATATTTCTATAGCTAGAGAACAAGTTCCATTGGCATTTCAAATTTTATCTGGTTTGTT ATTTTCTGAGGACTCTCCTATTGACAAATGGAAGATAACTGATATGAATAGAGTTTCTCAACAGTCAAGAGTTGGTATTGGTGCTCAATTTAC TTTGTATGTTAAATCTGATCAAGAATGTTCTCAGTATTCAGCTTTATTGTTGCATAAAATTAGACAATTCATAATGTGCTTGGAATCTAATTT GTTAAGATCTAAGATTGCTCCAGGTGAATATCCTGCATCTGATGTTAGACCAGAGGATTGGAAGTACGTTTCATATAGAAATGAATTGAGATC TGACAGAGATGGTTCTGAAAGACAAGAGCAGATGTTAAGAGAAGAACCTTTTTATAGATTGATGATTGAG

6-Adaptor bases, followed by “C” followed by another adaptor: GGTAGCGAT

7-Zippers: For RR:

Ggttctggttctggttctggttctctggaaatccgtgcggcgttcctggaaaaagaaaacaccgcgctgcgtacccgtgcggcggaactgcg taaacgtgttggtcgttgccgtaacatcgtttctaaatacgaaacccgttacggtccgctg

For EE:

Ggttccggtagcggttccggttctatcactattagggctgcttttttggaaaaagaaaatactgctttgagaactgaaattgctgaattgga aaaagaagttggtagatgtgaaaatattgtttctaaatatgaaactagatatggtccattg

For RR(T):

Ggatctggatcgggatctgatccagatttggaaattagagctgcttttttgagacaaagaaatactgctttgagaactgaagttgctgaatt ggaacaagaagttcaaagattggaaaatgaagtttctcaatatgaaactagatatggtccattgggtggtggtaaa

For EE(T):

ggatctggatcgggatctgatccagatttggaaattgaagctgcttttttggaaagagaaaatactgctttggaaactagagttgctgaatt gagacaaagagttcaaagattgagaaatagagtttctcaatatagaactagatatggtccattgggtggtggtaaa


8-Final adaptors, followed by “D”, followed by BamHI, 3 STOPS in three different frames, then NotI, the Adh terminator and SacI:


TAATGCGGGATCCTGAGTAAATAAGCGGCCGCGCGAATTTC TTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAAATAAGTGTAT ACAAATTTTAAAGTGACTCTTAGGTTTTAAAACGAAAATTCTTATTCTTGAGT AACTCTTTCCTGTGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTT ATTGACCACACCGAGCTC



pFig1

TTGAATGATCAACCAAACGCCGATATAGTCACTATTGGTGATAAAATTAAAATGCAGCTATTGAGAACCCATCCTAACAACATTAAATTGTCTATTAATGGAATTGGTAAAGATGCCCCAACTTTCCAAGAATCTGCTTTGATTGCCGATAAGTTATTGAGTGTCATGAAGGCCGGCACTTACCCAAAGATTTCCATTTTCTACAATGACCCAGTGTCTTCCCTATCTTTTGAACCATCTGAAAAACCGATCTTTAACGCCAAGACCATTGAACAATCCCCATCATTCGGCAAATTTGAGATCGACACGGACGCAAACGTTCCAAGAGATTTGTTTGAATATACTTTGGCTAACCAAATGTTGACAGCAATGGCTCAAGGTTATGCTGCTGAAATTTCCGCCAGAAGAAACGCTATGGATAACGCTTCCAAGAATGCCGGTGATATGATCAATCGTTACTCTATCTTGTACAACAGAACAAGACAAGCTGTCATTACTAATGAACTGGTTGATATTATTACTGGTGCTTCCTCTTTGGGATGATAAAAAAATCACCCTGCATTGCCTCTTTATTTGACGTTGTTTTTGTAGAACATGAAACGAATTTTGACTTGATGAGACGAAGTATATATCCAAAGAATACCTTAAATAGAAAAGGAAAGATAATAAATACTAAACACTACTATATATTCAGGTAAAATACAAAAATTATAACATTTTTAAAACTTTTTTTTTTTGAAAGTCCTTCTCGCTTTAGGATTTTTTCCCATTAAGATTATGATGGTTTCATGTATGTGTCAGTTAAAAAAAATATGGCTAAGTAGCAATGAAACGAACCAAGAAAATGAAAACAATATATAGTGCTGTTGAAATAACAAAGACATTGGTATATATTTGTAAAATGTCTGTTAAATGTTTTTTATCTCAGGTTCTTGCTTGTCTTTGGTAGAAGAAATTATAGTAAACAAACAAACAAACAAACAAAAAAAAAAAAAAAAAA

pAdh

TTAAAACAAGAAGAGGGTTGACTACATCACGATGAGGGGGATCGAAGAAATGATGGTAAATGAAATAGGAAATCAAGGAGCATGAAGGCAAAAGACAAATATAAGGGTCGAACGAAAAATAAAGTGAAAAGTGTTGATATGATGTATTTGGCTTTGCGGCGCCGAAAAAACGAGTTTACGCAATTGCACAATCATGCTGACTCTGTGGCGGACCCGCGCTCTTGCCGGCCCGGCGATAACGCTGGGCGTGAGGCTGTGCCCGGCGGAGTTTTTTGCGCCTGCATTTTCCAAGGTTTACCCTGCGCTAAGGGGCGAGATTGGAGAAGCAATAAGAATGCCGGTTGGGGTTGCGATGATGACGACCACGACAACTGGTGTCATTATTTAAGTTGCCGAAAGAACCTGAGTGCATTTGCAACATGAGTATACTAGAAGAATGAGCCAAGACTTGCGAGACGCGAGTTTGCCGGTGGTGCGAACAATAGAGCGACCATGACCTTGAAGGTGAGACGCGCATAACCGCTAGAGTACTTTGAAGAGGAAACAGCAATAGGGTTGCTACCAGTATAAATAGACAGGTACATACAACACTGGAAATGGTTGTCTGTTTGAGTACGCTTTCAATTCATTTGGGTGTGCACTTTATTATGTTACAATATGGAAGGGAACTTTACACTTCTCCTATGCACATATATTAATTAAAGTCCAATGCTAGTAGAGAAGGGGGGTAACACCCCTCCGCGCTCTTTTCCGATTTTTTTCTAAACCGTGGAATATTTCGGATATCCTTTTGTTGTTTCCGGGTGTACAATATGGACTTCCTCTTTTCTGGCAACCAAACCCATACATCGGGATTCCTATAATACCTTCGTTGGTCTCCCTAACATGTAGGTGGCGGAGGGGAGATATACAATAGAACAGATACCAGACAAGACATAATGGGCTAAACAAGACTACACCAATTACACTGCCTCATTGATGGTGGTACATAACGAACTAATACTGTAGCCCTAGACTTGATAGCCATCATCATATCGAAGTTTCACTACCCTTTTTCCATTTGCCATCTATTGAAGTAATAATAGGCGCATGCAACTTCTTTTCTTTTTTTTTCTTTTCTCTCTCCCCCGTTGTTGTCTCACCATATCCGCAATGACAAAAAAATGATGGAAGACACTAAAGGAAAAAATTAACGACAAAGACAGCACCAACAGATGTCGTTGTTCCAGAGCTGATGAGGGGTATCTCGAAGCACACGAAACTTTTTCCTTCCTTCATTCACGCACACTACTCTCTAATGAGCAACGGTATACGGCCTTCCTTCCAGTTACTTGAATTTGAAATAAAAAAAAGTTTGCTGTCTTGCTATCAAGTATAAATAGACCTGCAATTATTAATCTTTTGTTTCCTCGTCATTGTTCTCGTTCCCTTTCTTCCTTGTTTCTTTTTCTGCACAATATTTCAAGCTATACCAAGCATACAATCAACTATCTCATATACA


pCyc

cagatccgccaggcgtgtatatatagcgtggatggccaggcaactttagtgctgacacatacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctatagacacacaaacacaaatacacacactaaattaata


pSte5

CACGAAGTGACTGACAGAATACTGACATCAGCTGATTTCTCATAGAGCTGTTTCTCTGATAACACGTTGTTTGAACATCGACAAGATGAAAATCTAGAAGTATCAAGTTTCCTTTAAAGGGATATATAACAGATTCTAAAACTGACAGAAATATTTCGAGTGAAGAAGAAGCGTTAAATATTGGATCTTTCCGCAGTTCTACTCTGATACATTTTTGAAGTAGGAGAGTCATTTAGAAGGCGTATTGCTCAATAGTAGAAAGCAGGCCTGTGCACATGAATTAATTAAAAAATATAAAGGTAGTGATTAGACGACACATGTCCATAGGTAACCTGTCATAATTTTGAACAATTTCCCTTCTTTTCTTTTTTTTTTTTGGGTGCGGCGATATGTAGCTTGTTAATTTACACATCATGTACTTTTCTGCATCAAAATATGAAAGGCGATAGTAGCTAAAGAAAATACCGAGAATTTCCTCGAAAAGTTGACGACAAAAGAAAGGCATAAAAAAGTAATTTGAAAATATTTTAAAACTGTTTTAACCCATCTAGCATCCGCGCTAAAAAAGGAAGATACAGGATACAGCGGAAACAACTTTTAA

Personal tools