IGEM:UCSF/2007/Plasmids

From OpenWetWare

< IGEM:UCSF/2007(Difference between revisions)
Jump to: navigation, search
Current revision (15:33, 16 August 2007) (view source)
 
Line 107: Line 107:
pFig1
pFig1
-
TTGAATGATCAACCAAACGCCGATATAGTCACTATTGGTGATAAAATTAAAATGCAGCTATTGAGAACCCATCCTAACAACATTAAATTGTCTATTAATGGAATTGGTAAAGATGCCCCAACTTTCCAAGAATCTGCTTTGATTGCCGATAAGTTATTGAGTGTCATGAAGGCCGGCACTTACCCAAAGATTTCCATTTTCTACAATGACCCAGTGTCTTCCCTATCTTTTGAACCATCTGAAAAACCGATCTTTAACGCCAAGACCATTGAACAATCCCCATCATTCGGCAAATTTGAGATCGACACGGACGCAAACGTTCCAAGAGATTTGTTTGAATATACTTTGGCTAACCAAATGTTGACAGCAATGGCTCAAGGTTATGCTGCTGAAATTTCCGCCAGAAGAAACGCTATGGATAACGCTTCCAAGAATGCCGGTGATATGATCAATCGTTACTCTATCTTGTACAACAGAACAAGACAAGCTGTCATTACTAATGAACTGGTTGATATTATTACTGGTGCTTCCTCTTTGGGATGATAAAAAAATCACCCTGCATTGCCTCTTTATTTGACGTTGTTTTTGTAGAACATGAAACGAATTTTGACTTGATGAGACGAAGTATATATCCAAAGAATACCTTAAATAGAAAAGGAAAGATAATAAATACTAAACACTACTATATATTCAGGTAAAATACAAAAATTATAACATTTTTAAAACTTTTTTTTTTTGAAAGTCCTTCTCGCTTTAGGATTTTTTCCCATTAAGATTATGATGGTTTCATGTATGTGTCAGTTAAAAAAAATATGGCTAAGTAGCAATGAAACGAACCAAGAAAATGAAAACAATATATAGTGCTGTTGAAATAACAAAGACATTGGTATATATTTGTAAAATGTCTGTTAAATGTTTTTTATCTCAGGTTCTTGCTTGTCTTTGGTAGAAGAAATTATAGTAAACAAACAAACAAACAAACAAAAAAAAAAAAAAAAAA
+
TTGAATGATCAACCAAACGCCGATATAGTCACTATTGGTGATAAAATTAAAATGC
 +
AGCTATTGAGAACCCATCCTAACAACATTAAATTGTCTATTAATGGAATTGGTAA
 +
AGATGCCCCAACTTTCCAAGAATCTGCTTTGATTGCCGATAAGTTATTGAGTGTC
 +
ATGAAGGCCGGCACTTACCCAAAGATTTCCATTTTCTACAATGACCCAGTGTCTT
 +
CCCTATCTTTTGAACCATCTGAAAAACCGATCTTTAACGCCAAGACCATTGAACA
 +
ATCCCCATCATTCGGCAAATTTGAGATCGACACGGACGCAAACGTTCCAAGAGAT
 +
TTGTTTGAATATACTTTGGCTAACCAAATGTTGACAGCAATGGCTCAAGGTTATG
 +
CTGCTGAAATTTCCGCCAGAAGAAACGCTATGGATAACGCTTCCAAGAATGCCGG
 +
TGATATGATCAATCGTTACTCTATCTTGTACAACAGAACAAGACAAGCTGTCATT
 +
ACTAATGAACTGGTTGATATTATTACTGGTGCTTCCTCTTTGGGATGATAAAAAA
 +
ATCACCCTGCATTGCCTCTTTATTTGACGTTGTTTTTGTAGAACATGAAACGAAT
 +
TTTGACTTGATGAGACGAAGTATATATCCAAAGAATACCTTAAATAGAAAAGGAA
 +
AGATAATAAATACTAAACACTACTATATATTCAGGTAAAATACAAAAATTATAAC
 +
ATTTTTAAAACTTTTTTTTTTTGAAAGTCCTTCTCGCTTTAGGATTTTTTCCCAT
 +
TAAGATTATGATGGTTTCATGTATGTGTCAGTTAAAAAAAATATGGCTAAGTAGC
 +
AATGAAACGAACCAAGAAAATGAAAACAATATATAGTGCTGTTGAAATAACAAAG
 +
ACATTGGTATATATTTGTAAAATGTCTGTTAAATGTTTTTTATCTCAGGTTCTTG
 +
CTTGTCTTTGGTAGAAGAAATTATAGTAAACAAACAAACAAACAAACAAAAAAAA
 +
AAAAAAAAAA
pAdh
pAdh
-
TTAAAACAAGAAGAGGGTTGACTACATCACGATGAGGGGGATCGAAGAAATGATGGTAAATGAAATAGGAAATCAAGGAGCATGAAGGCAAAAGACAAATATAAGGGTCGAACGAAAAATAAAGTGAAAAGTGTTGATATGATGTATTTGGCTTTGCGGCGCCGAAAAAACGAGTTTACGCAATTGCACAATCATGCTGACTCTGTGGCGGACCCGCGCTCTTGCCGGCCCGGCGATAACGCTGGGCGTGAGGCTGTGCCCGGCGGAGTTTTTTGCGCCTGCATTTTCCAAGGTTTACCCTGCGCTAAGGGGCGAGATTGGAGAAGCAATAAGAATGCCGGTTGGGGTTGCGATGATGACGACCACGACAACTGGTGTCATTATTTAAGTTGCCGAAAGAACCTGAGTGCATTTGCAACATGAGTATACTAGAAGAATGAGCCAAGACTTGCGAGACGCGAGTTTGCCGGTGGTGCGAACAATAGAGCGACCATGACCTTGAAGGTGAGACGCGCATAACCGCTAGAGTACTTTGAAGAGGAAACAGCAATAGGGTTGCTACCAGTATAAATAGACAGGTACATACAACACTGGAAATGGTTGTCTGTTTGAGTACGCTTTCAATTCATTTGGGTGTGCACTTTATTATGTTACAATATGGAAGGGAACTTTACACTTCTCCTATGCACATATATTAATTAAAGTCCAATGCTAGTAGAGAAGGGGGGTAACACCCCTCCGCGCTCTTTTCCGATTTTTTTCTAAACCGTGGAATATTTCGGATATCCTTTTGTTGTTTCCGGGTGTACAATATGGACTTCCTCTTTTCTGGCAACCAAACCCATACATCGGGATTCCTATAATACCTTCGTTGGTCTCCCTAACATGTAGGTGGCGGAGGGGAGATATACAATAGAACAGATACCAGACAAGACATAATGGGCTAAACAAGACTACACCAATTACACTGCCTCATTGATGGTGGTACATAACGAACTAATACTGTAGCCCTAGACTTGATAGCCATCATCATATCGAAGTTTCACTACCCTTTTTCCATTTGCCATCTATTGAAGTAATAATAGGCGCATGCAACTTCTTTTCTTTTTTTTTCTTTTCTCTCTCCCCCGTTGTTGTCTCACCATATCCGCAATGACAAAAAAATGATGGAAGACACTAAAGGAAAAAATTAACGACAAAGACAGCACCAACAGATGTCGTTGTTCCAGAGCTGATGAGGGGTATCTCGAAGCACACGAAACTTTTTCCTTCCTTCATTCACGCACACTACTCTCTAATGAGCAACGGTATACGGCCTTCCTTCCAGTTACTTGAATTTGAAATAAAAAAAAGTTTGCTGTCTTGCTATCAAGTATAAATAGACCTGCAATTATTAATCTTTTGTTTCCTCGTCATTGTTCTCGTTCCCTTTCTTCCTTGTTTCTTTTTCTGCACAATATTTCAAGCTATACCAAGCATACAATCAACTATCTCATATACA
+
TTAAAACAAGAAGAGGGTTGACTACATCACGATGAGGGGGATCGAAGAAATGATG
 +
GTAAATGAAATAGGAAATCAAGGAGCATGAAGGCAAAAGACAAATATAAGGGTCG
 +
AACGAAAAATAAAGTGAAAAGTGTTGATATGATGTATTTGGCTTTGCGGCGCCGA
 +
AAAAACGAGTTTACGCAATTGCACAATCATGCTGACTCTGTGGCGGACCCGCGCT
 +
CTTGCCGGCCCGGCGATAACGCTGGGCGTGAGGCTGTGCCCGGCGGAGTTTTTTG
 +
CGCCTGCATTTTCCAAGGTTTACCCTGCGCTAAGGGGCGAGATTGGAGAAGCAAT
 +
AAGAATGCCGGTTGGGGTTGCGATGATGACGACCACGACAACTGGTGTCATTATT
 +
TAAGTTGCCGAAAGAACCTGAGTGCATTTGCAACATGAGTATACTAGAAGAATGA
 +
GCCAAGACTTGCGAGACGCGAGTTTGCCGGTGGTGCGAACAATAGAGCGACCATG
 +
ACCTTGAAGGTGAGACGCGCATAACCGCTAGAGTACTTTGAAGAGGAAACAGCAA
 +
TAGGGTTGCTACCAGTATAAATAGACAGGTACATACAACACTGGAAATGGTTGTC
 +
TGTTTGAGTACGCTTTCAATTCATTTGGGTGTGCACTTTATTATGTTACAATATG
 +
GAAGGGAACTTTACACTTCTCCTATGCACATATATTAATTAAAGTCCAATGCTAG
 +
TAGAGAAGGGGGGTAACACCCCTCCGCGCTCTTTTCCGATTTTTTTCTAAACCGT
 +
GGAATATTTCGGATATCCTTTTGTTGTTTCCGGGTGTACAATATGGACTTCCTCT
 +
TTTCTGGCAACCAAACCCATACATCGGGATTCCTATAATACCTTCGTTGGTCTCC
 +
CTAACATGTAGGTGGCGGAGGGGAGATATACAATAGAACAGATACCAGACAAGAC
 +
ATAATGGGCTAAACAAGACTACACCAATTACACTGCCTCATTGATGGTGGTACAT
 +
AACGAACTAATACTGTAGCCCTAGACTTGATAGCCATCATCATATCGAAGTTTCA
 +
CTACCCTTTTTCCATTTGCCATCTATTGAAGTAATAATAGGCGCATGCAACTTCT
 +
TTTCTTTTTTTTTCTTTTCTCTCTCCCCCGTTGTTGTCTCACCATATCCGCAATG
 +
ACAAAAAAATGATGGAAGACACTAAAGGAAAAAATTAACGACAAAGACAGCACCA
 +
ACAGATGTCGTTGTTCCAGAGCTGATGAGGGGTATCTCGAAGCACACGAAACTTT
 +
TTCCTTCCTTCATTCACGCACACTACTCTCTAATGAGCAACGGTATACGGCCTTC
 +
CTTCCAGTTACTTGAATTTGAAATAAAAAAAAGTTTGCTGTCTTGCTATCAAGTA
 +
TAAATAGACCTGCAATTATTAATCTTTTGTTTCCTCGTCATTGTTCTCGTTCCCT
 +
TTCTTCCTTGTTTCTTTTTCTGCACAATATTTCAAGCTATACCAAGCATACAATC
 +
AACTATCTCATATACA
pCyc
pCyc
-
cagatccgccaggcgtgtatatatagcgtggatggccaggcaactttagtgctgacacatacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctatagacacacaaacacaaatacacacactaaattaata
+
cagatccgccaggcgtgtatatatagcgtggatggccaggcaactttagtgctga
 +
cacatacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatg
 +
tgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttcc
 +
ttatacattaggacctttgcagcataaattactatacttctatagacacacaaac
 +
acaaatacacacactaaattaata
pSte5
pSte5
-
CACGAAGTGACTGACAGAATACTGACATCAGCTGATTTCTCATAGAGCTGTTTCTCTGATAACACGTTGTTTGAACATCGACAAGATGAAAATCTAGAAGTATCAAGTTTCCTTTAAAGGGATATATAACAGATTCTAAAACTGACAGAAATATTTCGAGTGAAGAAGAAGCGTTAAATATTGGATCTTTCCGCAGTTCTACTCTGATACATTTTTGAAGTAGGAGAGTCATTTAGAAGGCGTATTGCTCAATAGTAGAAAGCAGGCCTGTGCACATGAATTAATTAAAAAATATAAAGGTAGTGATTAGACGACACATGTCCATAGGTAACCTGTCATAATTTTGAACAATTTCCCTTCTTTTCTTTTTTTTTTTTGGGTGCGGCGATATGTAGCTTGTTAATTTACACATCATGTACTTTTCTGCATCAAAATATGAAAGGCGATAGTAGCTAAAGAAAATACCGAGAATTTCCTCGAAAAGTTGACGACAAAAGAAAGGCATAAAAAAGTAATTTGAAAATATTTTAAAACTGTTTTAACCCATCTAGCATCCGCGCTAAAAAAGGAAGATACAGGATACAGCGGAAACAACTTTTAA
+
CACGAAGTGACTGACAGAATACTGACATCAGCTGATTTCTCATAGAGCTGTTTCT
 +
CTGATAACACGTTGTTTGAACATCGACAAGATGAAAATCTAGAAGTATCAAGTTT
 +
CCTTTAAAGGGATATATAACAGATTCTAAAACTGACAGAAATATTTCGAGTGAAG
 +
AAGAAGCGTTAAATATTGGATCTTTCCGCAGTTCTACTCTGATACATTTTTGAAG
 +
TAGGAGAGTCATTTAGAAGGCGTATTGCTCAATAGTAGAAAGCAGGCCTGTGCAC
 +
ATGAATTAATTAAAAAATATAAAGGTAGTGATTAGACGACACATGTCCATAGGTA
 +
ACCTGTCATAATTTTGAACAATTTCCCTTCTTTTCTTTTTTTTTTTTGGGTGCGG
 +
CGATATGTAGCTTGTTAATTTACACATCATGTACTTTTCTGCATCAAAATATGAA
 +
AGGCGATAGTAGCTAAAGAAAATACCGAGAATTTCCTCGAAAAGTTGACGACAAA
 +
AGAAAGGCATAAAAAAGTAATTTGAAAATATTTTAAAACTGTTTTAACCCATCTA
 +
GCATCCGCGCTAAAAAAGGAAGATACAGGATACAGCGGAAACAACTTTTAA

Current revision

Expected sequences

Below you have the sequences of the different parts in the right order, as well as the adaptor sequences between parts. You will need to arrange them accordingly to your particular constructs, so that you will have 1-2-3-4-5-6-7-8.

1-Promoter sequence (variable, depends on particular acceptor)

2-ATG-XhoI-“A” and 2 adaptor bases: ATGCTCGAGGGAGCT


3-mCherry:

GTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACG AGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCC CTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAG CTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGC AGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTG GGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCAC TACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCA CCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG

4-Adaptor bases, followed by “B” and another adaptor base: GGTAGTTCCCTA

5-Effectors

For YopH:

aacttatcattaagcgatcttcatcgtcaggtatctcgattggtgcagcaagagagcggtgattgtaccgggaaattaagaggtaacgt tgctgccaataaagaaactacctttcaaggtttgaccatagccagtggagccagagagtcagaaaaagtatttgctcaaactgtactaa gccacgtagcaaatgttgttctaactcaagaagataccgctaagctattgcaaagtacggtaaagcataatttgaataattatgactta agaagtgtcggcaatggtaatagtgtacttgtcagtttacgtagtgaccaaatgacactacaagacgccaaagtgctgttggaggccgc attgcgacaagagtcgggagcgagggggcatgtatcatctcattcacattcagcccttcacgcaccgggaaccccggtgcgtgaaggac tgcgttcacatctagaccccagaactccaccgttgccaccgcgtgaacgaccacacacttctggccatcacggggctggcgaagccaga gccaccgcaccaagcactgtttctccttatggcccagaagcgcgcgcagaactcagcagccgcctcaccacattgcgcaatacgctggc gccagcaacgaatgatccgcgttacttacaagcctgcggcggtgaaaagctaaaccgatttagagatattcaatgctgtcggcaaaccg cagtacgcgccgatcttaatgccaattacatccaggtcggtaacactcgtaccatagcgtgccagtatccgctacaatctcaacttgaa agccatttccgtatgctggcagaaaaccgaacgccagtgttggctgttttagcgtccagttctgagatagccaatcaaagattcggtat gccagattatttccgccagagtggtacctatggcagtatcactgtagagtctaaaatgactcagcaagttggtctcggtgacgggatta tggcagatatgtatactttaacgattcgtgaagcgggtcaaaaaacaatctctgttcctgtggttcatgttggcaattggcccgatcag accgcagtcagctctgaagttaccaaggcactcgcttcactggtagatcaaacagcagaaacaaaacgcaatatgtatgaaagcaaagg aagttcagcggtaggagatgactccaaattacggccggtaatacattgccgtgcgggtgttggccgtactgcgcaactgattggcgcaa tgtgcatgaatgatagtcgtaatagtcagttaagcgtagaagatatggtcagccaaatgcgagtacaaagaaatggtattatggtacaa aaagatgagcaacttgatgttctgattaagttggctgaaggacaagggcgaccattattaaatagc

For YopJ:

atcggaccaatatcacaaataaatatctccggtggcttatcagaaaaagagaccagttctttaatcagtaatgaagagcttaaaaatat cataacacagttggaaactgatatatcggatggatcctggttccataaaaattattcacgtatggatgtagaagtcatgcccgcattgg taatccaggcgaacaataaatatccggaaatgaatcttaatcttgttacatctccattggacctttcaatagaaataaaaaacgtcata gaaaatggagttagatcttcccgcttcataattaacatgggggaaggtggaatacatttcagtgtaattgattacaaacatataaatggg aaaacatctctgatattgtttgaaccagcaaactttaacagtatggggccagcgatgctggcaataaggacaaaaacggctattgaacgt tatcaattacctgattgccatttctccatggtggaaatggatattcagcgaagctcatctgaatgtggtatttttagtttggcactggca aaaaaactttacatcgagagagatagcctgttgaaaatacatgaagataatataaaaggtatattaagtgatggtgaaaatcctttaccc cacgataagttggacccgtatctcccggtaactttttacaaacatactcaaggtaaaaaacgtcttaatgaatatttaaatactaacccg cagggagttggtactgttgttaacaaaaaaaatgaaaccatcgttaatagatttgataacaataaatccattgtagatggaaaggaatta tcagtttcggtacataaaaagagaatagctgaatataaaacacttctcaaagta

For OspF:

CCAATTAAAAAGCCTTGTTTGAAATTGAATTTAGATTCTTTGAACGTTGTTAGATCAGAAATTCCACAAATGTTATCTGCTAATGAAAGAT TGAAAAATAATTTTAACATTTTATATAATCAAATAAGACAGTACCCAGCTTATTATTTTAAAGTTGCTTCTAATGTTCCTACTTACTCTGA TATATGTCAATTTTTCTCAGTTATGTATCAAGGTTTTCAGATAGTTAATCATTCTGGTGATGTTTTTATTCATGCTTGTAGAGAAAATCCA CAATCTAAAGGTGATTTTGTTGGTGACAAGTTCCATATTTCTATAGCTAGAGAACAAGTTCCATTGGCATTTCAAATTTTATCTGGTTTGTT ATTTTCTGAGGACTCTCCTATTGACAAATGGAAGATAACTGATATGAATAGAGTTTCTCAACAGTCAAGAGTTGGTATTGGTGCTCAATTTAC TTTGTATGTTAAATCTGATCAAGAATGTTCTCAGTATTCAGCTTTATTGTTGCATAAAATTAGACAATTCATAATGTGCTTGGAATCTAATTT GTTAAGATCTAAGATTGCTCCAGGTGAATATCCTGCATCTGATGTTAGACCAGAGGATTGGAAGTACGTTTCATATAGAAATGAATTGAGATC TGACAGAGATGGTTCTGAAAGACAAGAGCAGATGTTAAGAGAAGAACCTTTTTATAGATTGATGATTGAG

6-Adaptor bases, followed by “C” followed by another adaptor: GGTAGCGAT

7-Zippers: For RR:

Ggttctggttctggttctggttctctggaaatccgtgcggcgttcctggaaaaagaaaacaccgcgctgcgtacccgtgcggcggaactgcg taaacgtgttggtcgttgccgtaacatcgtttctaaatacgaaacccgttacggtccgctg

For EE:

Ggttccggtagcggttccggttctatcactattagggctgcttttttggaaaaagaaaatactgctttgagaactgaaattgctgaattgga aaaagaagttggtagatgtgaaaatattgtttctaaatatgaaactagatatggtccattg

For RR(T):

Ggatctggatcgggatctgatccagatttggaaattagagctgcttttttgagacaaagaaatactgctttgagaactgaagttgctgaatt ggaacaagaagttcaaagattggaaaatgaagtttctcaatatgaaactagatatggtccattgggtggtggtaaa

For EE(T):

ggatctggatcgggatctgatccagatttggaaattgaagctgcttttttggaaagagaaaatactgctttggaaactagagttgctgaatt gagacaaagagttcaaagattgagaaatagagtttctcaatatagaactagatatggtccattgggtggtggtaaa


8-Final adaptors, followed by “D”, followed by BamHI, 3 STOPS in three different frames, then NotI, the Adh terminator and SacI:


TAATGCGGGATCCTGAGTAAATAAGCGGCCGCGCGAATTTC TTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAAATAAGTGTAT ACAAATTTTAAAGTGACTCTTAGGTTTTAAAACGAAAATTCTTATTCTTGAGT AACTCTTTCCTGTGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTT ATTGACCACACCGAGCTC



pFig1

TTGAATGATCAACCAAACGCCGATATAGTCACTATTGGTGATAAAATTAAAATGC AGCTATTGAGAACCCATCCTAACAACATTAAATTGTCTATTAATGGAATTGGTAA AGATGCCCCAACTTTCCAAGAATCTGCTTTGATTGCCGATAAGTTATTGAGTGTC ATGAAGGCCGGCACTTACCCAAAGATTTCCATTTTCTACAATGACCCAGTGTCTT CCCTATCTTTTGAACCATCTGAAAAACCGATCTTTAACGCCAAGACCATTGAACA ATCCCCATCATTCGGCAAATTTGAGATCGACACGGACGCAAACGTTCCAAGAGAT TTGTTTGAATATACTTTGGCTAACCAAATGTTGACAGCAATGGCTCAAGGTTATG CTGCTGAAATTTCCGCCAGAAGAAACGCTATGGATAACGCTTCCAAGAATGCCGG TGATATGATCAATCGTTACTCTATCTTGTACAACAGAACAAGACAAGCTGTCATT ACTAATGAACTGGTTGATATTATTACTGGTGCTTCCTCTTTGGGATGATAAAAAA ATCACCCTGCATTGCCTCTTTATTTGACGTTGTTTTTGTAGAACATGAAACGAAT TTTGACTTGATGAGACGAAGTATATATCCAAAGAATACCTTAAATAGAAAAGGAA AGATAATAAATACTAAACACTACTATATATTCAGGTAAAATACAAAAATTATAAC ATTTTTAAAACTTTTTTTTTTTGAAAGTCCTTCTCGCTTTAGGATTTTTTCCCAT TAAGATTATGATGGTTTCATGTATGTGTCAGTTAAAAAAAATATGGCTAAGTAGC AATGAAACGAACCAAGAAAATGAAAACAATATATAGTGCTGTTGAAATAACAAAG ACATTGGTATATATTTGTAAAATGTCTGTTAAATGTTTTTTATCTCAGGTTCTTG CTTGTCTTTGGTAGAAGAAATTATAGTAAACAAACAAACAAACAAACAAAAAAAA AAAAAAAAAA

pAdh

TTAAAACAAGAAGAGGGTTGACTACATCACGATGAGGGGGATCGAAGAAATGATG GTAAATGAAATAGGAAATCAAGGAGCATGAAGGCAAAAGACAAATATAAGGGTCG AACGAAAAATAAAGTGAAAAGTGTTGATATGATGTATTTGGCTTTGCGGCGCCGA AAAAACGAGTTTACGCAATTGCACAATCATGCTGACTCTGTGGCGGACCCGCGCT CTTGCCGGCCCGGCGATAACGCTGGGCGTGAGGCTGTGCCCGGCGGAGTTTTTTG CGCCTGCATTTTCCAAGGTTTACCCTGCGCTAAGGGGCGAGATTGGAGAAGCAAT AAGAATGCCGGTTGGGGTTGCGATGATGACGACCACGACAACTGGTGTCATTATT TAAGTTGCCGAAAGAACCTGAGTGCATTTGCAACATGAGTATACTAGAAGAATGA GCCAAGACTTGCGAGACGCGAGTTTGCCGGTGGTGCGAACAATAGAGCGACCATG ACCTTGAAGGTGAGACGCGCATAACCGCTAGAGTACTTTGAAGAGGAAACAGCAA TAGGGTTGCTACCAGTATAAATAGACAGGTACATACAACACTGGAAATGGTTGTC TGTTTGAGTACGCTTTCAATTCATTTGGGTGTGCACTTTATTATGTTACAATATG GAAGGGAACTTTACACTTCTCCTATGCACATATATTAATTAAAGTCCAATGCTAG TAGAGAAGGGGGGTAACACCCCTCCGCGCTCTTTTCCGATTTTTTTCTAAACCGT GGAATATTTCGGATATCCTTTTGTTGTTTCCGGGTGTACAATATGGACTTCCTCT TTTCTGGCAACCAAACCCATACATCGGGATTCCTATAATACCTTCGTTGGTCTCC CTAACATGTAGGTGGCGGAGGGGAGATATACAATAGAACAGATACCAGACAAGAC ATAATGGGCTAAACAAGACTACACCAATTACACTGCCTCATTGATGGTGGTACAT AACGAACTAATACTGTAGCCCTAGACTTGATAGCCATCATCATATCGAAGTTTCA CTACCCTTTTTCCATTTGCCATCTATTGAAGTAATAATAGGCGCATGCAACTTCT TTTCTTTTTTTTTCTTTTCTCTCTCCCCCGTTGTTGTCTCACCATATCCGCAATG ACAAAAAAATGATGGAAGACACTAAAGGAAAAAATTAACGACAAAGACAGCACCA ACAGATGTCGTTGTTCCAGAGCTGATGAGGGGTATCTCGAAGCACACGAAACTTT TTCCTTCCTTCATTCACGCACACTACTCTCTAATGAGCAACGGTATACGGCCTTC CTTCCAGTTACTTGAATTTGAAATAAAAAAAAGTTTGCTGTCTTGCTATCAAGTA TAAATAGACCTGCAATTATTAATCTTTTGTTTCCTCGTCATTGTTCTCGTTCCCT TTCTTCCTTGTTTCTTTTTCTGCACAATATTTCAAGCTATACCAAGCATACAATC AACTATCTCATATACA


pCyc

cagatccgccaggcgtgtatatatagcgtggatggccaggcaactttagtgctga cacatacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatg tgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttcc ttatacattaggacctttgcagcataaattactatacttctatagacacacaaac acaaatacacacactaaattaata


pSte5

CACGAAGTGACTGACAGAATACTGACATCAGCTGATTTCTCATAGAGCTGTTTCT CTGATAACACGTTGTTTGAACATCGACAAGATGAAAATCTAGAAGTATCAAGTTT CCTTTAAAGGGATATATAACAGATTCTAAAACTGACAGAAATATTTCGAGTGAAG AAGAAGCGTTAAATATTGGATCTTTCCGCAGTTCTACTCTGATACATTTTTGAAG TAGGAGAGTCATTTAGAAGGCGTATTGCTCAATAGTAGAAAGCAGGCCTGTGCAC ATGAATTAATTAAAAAATATAAAGGTAGTGATTAGACGACACATGTCCATAGGTA ACCTGTCATAATTTTGAACAATTTCCCTTCTTTTCTTTTTTTTTTTTGGGTGCGG CGATATGTAGCTTGTTAATTTACACATCATGTACTTTTCTGCATCAAAATATGAA AGGCGATAGTAGCTAAAGAAAATACCGAGAATTTCCTCGAAAAGTTGACGACAAA AGAAAGGCATAAAAAAGTAATTTGAAAATATTTTAAAACTGTTTTAACCCATCTA GCATCCGCGCTAAAAAAGGAAGATACAGGATACAGCGGAAACAACTTTTAA

Personal tools