IGEM:UW/2008/Notebook/iGEM UW Team/2008/05/08

From OpenWetWare

< IGEM:UW | 2008 | Notebook | iGEM UW Team | 2008 | 05(Difference between revisions)
Jump to: navigation, search
Current revision (13:33, 12 June 2008) (view source)
 
Line 10: Line 10:
Primer sequences:
Primer sequences:
-
= T7lLinkB  CGGATCCGGCGGTGGCGGTAGTGGAGGAGGTGGGTCTGGAGGCGGAGGGAACACGATTAACATCGCTAAGAAC
+
T7lLinkB  CGGATCCGGCGGTGGCGGTAGTGGAGGAGGTGGGTCTGGAGGCGGAGGGAACACGATTAACATCGCTAAGAAC
-
= T7lRBSHi  CACAAGCTTAGGAGGTGTACTAGATGAACACGATTAACATCGCTAAG
+
T7lRBSHi  CACAAGCTTAGGAGGTGTACTAGATGAACACGATTAACATCGCTAAG
-
= T7pXbSal  TCTGTCGACTCTAGATTACGCGAACGCGAAGTCC
+
T7pXbSal  TCTGTCGACTCTAGATTACGCGAACGCGAAGTCC
-
= AIDlNrH  CGTAAGCTTAGGAGGTGTAGACCATGGACAGCCTCTTGATG
+
AIDlNrH  CGTAAGCTTAGGAGGTGTAGACCATGGACAGCCTCTTGATG
-
= AIDpLinB  CCACTACCGCCACCGCCGGATCCGCCACCTCCGCTGCCTCCACCACCAAGTCCCAAAGTACGAAATGC
+
AIDpLinB  CCACTACCGCCACCGCCGGATCCGCCACCTCCGCTGCCTCCACCACCAAGTCCCAAAGTACGAAATGC
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
<!-- ## Do not edit below this line unless you know what you are doing. ## -->

Current revision

University of Warsaw iGEM Team 2008 Main project page
Previous entry      Next entry

1. Design primers for AID and T7 RNA-polimerase

Primer sequences:

T7lLinkB  CGGATCCGGCGGTGGCGGTAGTGGAGGAGGTGGGTCTGGAGGCGGAGGGAACACGATTAACATCGCTAAGAAC
T7lRBSHi  CACAAGCTTAGGAGGTGTACTAGATGAACACGATTAACATCGCTAAG
T7pXbSal  TCTGTCGACTCTAGATTACGCGAACGCGAAGTCC
AIDlNrH   CGTAAGCTTAGGAGGTGTAGACCATGGACAGCCTCTTGATG
AIDpLinB  CCACTACCGCCACCGCCGGATCCGCCACCTCCGCTGCCTCCACCACCAAGTCCCAAAGTACGAAATGC


Personal tools