IGEM:UW/2008/Notebook/iGEM UW Team/2008/05/22

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
-
1. Projection of starters for sequencing something we want from pMPM-T5
+
1. Design of starters for sequencing something we want from pMPM-T5
Starters:
Starters:

Revision as of 04:23, 12 June 2008

University of Warsaw iGEM Team 2008 Main project page
Previous entry      Next entry

1. Design of starters for sequencing something we want from pMPM-T5

Starters:

pMPMT5seqF CTACTGTTTCTCCATACCCG

pMPMT5seqR GAAAATCTTCTCTCATCCGC

AIDseqP GCTTCGGCGCATCCTTTTG


Personal tools