JCA062306-Construction of pJ23004

From OpenWetWare
Revision as of 19:09, 1 July 2006 by JCAnderson (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

PCR ca1002F/R on pSB1A3-I13521 (987 bp, EcoRI/PstI, Neb2)
Sub into pSB1A3-I13521 (EcoRI/PstI, Neb2)
Product is pJ23004

ca1002F Forward EcoRI oligo to make XbaI blunter cassette
cttctggaattcgcggccgcaactagtgtccctatcag
ca1002R Reverse PstI oligo to make SpeI blunter cassette
gaagcctgcagcggccgctTctagAatataaacgcag

Retrieved from "https://openwetware.org/mediawiki/index.php?title=JCA062306-Construction_of_pJ23004&oldid=46598"