JCA062306-Construction of pJ23004

From OpenWetWare
Revision as of 19:09, 1 July 2006 by JCAnderson (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

PCR ca1002F/R on pSB1A3-I13521 (987 bp, EcoRI/PstI, Neb2)
Sub into pSB1A3-I13521 (EcoRI/PstI, Neb2)
Product is pJ23004

ca1002F Forward EcoRI oligo to make XbaI blunter cassette
cttctggaattcgcggccgcaactagtgtccctatcag
ca1002R Reverse PstI oligo to make SpeI blunter cassette
gaagcctgcagcggccgctTctagAatataaacgcag

Retrieved from "https://openwetware.org/mediawiki/index.php?title=JCA062306-Construction_of_pJ23004&oldid=46598"