Kafatos:Primers

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (06:47, 18 May 2006) (view source)
 
Line 16: Line 16:
| ~450bp
| ~450bp
| w/ T7 overhang, for RNAi
| w/ T7 overhang, for RNAi
-
| [[Kafatos:Meister, Stephan|Stephan]]
+
| [[User:Smeister|Smeister]]
|-
|-
| LacZ
| LacZ
Line 25: Line 25:
| ~550bp
| ~550bp
| w/ T7 overhang, for RNAi
| w/ T7 overhang, for RNAi
-
| [[Kafatos:Meister, Stephan|Stephan]]
+
| [[User:Smeister|Smeister]]
|-
|-
| ribosomal S7
| ribosomal S7
Line 34: Line 34:
| 460bp
| 460bp
| semiquantitative RT-PCR
| semiquantitative RT-PCR
-
| [[Kafatos:Meister, Stephan|Stephan]]
+
| [[User:Smeister|Smeister]]
|-
|-
| ribosomal S7
| ribosomal S7
Line 43: Line 43:
| 78bp
| 78bp
| quantitative RT-PCR
| quantitative RT-PCR
-
| [[Kafatos:Meister, Stephan|Stephan]]
+
| [[User:Smeister|Smeister]]
|-
|-
|  
|  
Line 61: Line 61:
|
|
| plasmid sequencing  
| plasmid sequencing  
-
| [[Kafatos:Meister, Stephan|Stephan]]
+
| [[User:Smeister|Smeister]]
|-
|-
|  
|  
Line 70: Line 70:
|
|
| plasmid sequencing  
| plasmid sequencing  
-
| [[Kafatos:Meister, Stephan|Stephan]]
+
| [[User:Smeister|Smeister]]
|-
|-
|
|
Line 79: Line 79:
|
|
| microarray  
| microarray  
-
| [[Kafatos:Meister, Stephan|Stephan]]
+
| [[User:Smeister|Smeister]]
|-
|-
|}
|}

Current revision

Click here to visit our NEW WEBSITE
The content below is most likely out of date. We also have a new lean and mean openwetware area.




Gene Target Forward Primer Name Forward sequence Reverse Primer Name Reverse sequence product size purpose remarks
GFP GFP-T7-Forward TAATACGACTCACTATAGGG CAAGACACGTGCTGAAGTCAA GFP-T7-Reverse TAATACGACTCACTATAGGG GCCTGAATTTAACCAGGAACC ~450bp w/ T7 overhang, for RNAi Smeister
LacZ LacZ-T7-Forward TAATACGACTCACTATAGGG AGAATCCGACGGGTTGTTACT LacZ-T7-Reverse TAATACGACTCACTATAGGG CACCACGCTCATCGATAATTT ~550bp w/ T7 overhang, for RNAi Smeister
ribosomal S7 S7-A GGCGATCATCATCTACGTGC S7-B GTAGCTGCTGCAAACTTCGG 460bp semiquantitative RT-PCR Smeister
ribosomal S7 AgS7 qRT-PCR F GTGCGCGAGTTGGAGAAGA AgS7 qRT-PCR R ATCGGTTTGGGCAGAATGC 78bp quantitative RT-PCR Smeister
M13/pUC-Forward CGCCAGGGTTTTCCCAGTCACGAC M13/pUC-Reverse AGCGGATAACAATTTCACACAGGA plasmid sequencing Stephan
SP6 Promoter CATACGATTTAGGTGACACTATAG plasmid sequencing Smeister
T7 Promoter 20mer TAATACGACTCACTATAGGG T3 Promoter 23mer GCAATTAACCCTCACTAAAGGGA plasmid sequencing Smeister
T7-d(T)24 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG(T)24 microarray Smeister
Personal tools