
From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (05:47, 18 May 2006) (view source)
Line 16: Line 16:
| ~450bp
| ~450bp
| w/ T7 overhang, for RNAi
| w/ T7 overhang, for RNAi
| [[Kafatos:Meister, Stephan|Stephan]]
| [[User:Smeister|Smeister]]
| LacZ
| LacZ
Line 25: Line 25:
| ~550bp
| ~550bp
| w/ T7 overhang, for RNAi
| w/ T7 overhang, for RNAi
| [[Kafatos:Meister, Stephan|Stephan]]
| [[User:Smeister|Smeister]]
| ribosomal S7
| ribosomal S7
Line 34: Line 34:
| 460bp
| 460bp
| semiquantitative RT-PCR
| semiquantitative RT-PCR
| [[Kafatos:Meister, Stephan|Stephan]]
| [[User:Smeister|Smeister]]
| ribosomal S7
| ribosomal S7
Line 43: Line 43:
| 78bp
| 78bp
| quantitative RT-PCR
| quantitative RT-PCR
| [[Kafatos:Meister, Stephan|Stephan]]
| [[User:Smeister|Smeister]]
Line 61: Line 61:
| plasmid sequencing  
| plasmid sequencing  
| [[Kafatos:Meister, Stephan|Stephan]]
| [[User:Smeister|Smeister]]
Line 70: Line 70:
| plasmid sequencing  
| plasmid sequencing  
| [[Kafatos:Meister, Stephan|Stephan]]
| [[User:Smeister|Smeister]]
Line 79: Line 79:
| microarray  
| microarray  
| [[Kafatos:Meister, Stephan|Stephan]]
| [[User:Smeister|Smeister]]

Current revision

Click here to visit our NEW WEBSITE
The content below is most likely out of date. We also have a new lean and mean openwetware area.

Gene Target Forward Primer Name Forward sequence Reverse Primer Name Reverse sequence product size purpose remarks
ribosomal S7 S7-A GGCGATCATCATCTACGTGC S7-B GTAGCTGCTGCAAACTTCGG 460bp semiquantitative RT-PCR Smeister
SP6 Promoter CATACGATTTAGGTGACACTATAG plasmid sequencing Smeister
T7 Promoter 20mer TAATACGACTCACTATAGGG T3 Promoter 23mer GCAATTAACCCTCACTAAAGGGA plasmid sequencing Smeister
Personal tools