
From OpenWetWare

Revision as of 05:41, 18 May 2006 by Smeister (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
Click here to visit our NEW WEBSITE
The content below is most likely out of date. We also have a new lean and mean openwetware area.

Gene Target Forward Primer Name Forward sequence Reverse Primer Name Reverse sequence product size purpose remarks
ribosomal S7 S7-A GGCGATCATCATCTACGTGC S7-B GTAGCTGCTGCAAACTTCGG 460bp semiquantitative RT-PCR Stephan
SP6 Promoter CATACGATTTAGGTGACACTATAG plasmid sequencing Stephan
T7 Promoter 20mer TAATACGACTCACTATAGGG T3 Promoter 23mer GCAATTAACCCTCACTAAAGGGA plasmid sequencing Stephan
Personal tools