Kafatos:Primers

From OpenWetWare

Revision as of 06:41, 18 May 2006 by Smeister (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
Home Lab Members Research Publications Contact




Gene Target Forward Primer Name Forward sequence Reverse Primer Name Reverse sequence product size purpose remarks
GFP GFP-T7-Forward TAATACGACTCACTATAGGG CAAGACACGTGCTGAAGTCAA GFP-T7-Reverse TAATACGACTCACTATAGGG GCCTGAATTTAACCAGGAACC ~450bp w/ T7 overhang, for RNAi Stephan
LacZ LacZ-T7-Forward TAATACGACTCACTATAGGG AGAATCCGACGGGTTGTTACT LacZ-T7-Reverse TAATACGACTCACTATAGGG CACCACGCTCATCGATAATTT ~550bp w/ T7 overhang, for RNAi Stephan
ribosomal S7 S7-A GGCGATCATCATCTACGTGC S7-B GTAGCTGCTGCAAACTTCGG 460bp semiquantitative RT-PCR Stephan
ribosomal S7 AgS7 qRT-PCR F GTGCGCGAGTTGGAGAAGA AgS7 qRT-PCR R ATCGGTTTGGGCAGAATGC 78bp quantitative RT-PCR Stephan
M13/pUC-Forward CGCCAGGGTTTTCCCAGTCACGAC M13/pUC-Reverse AGCGGATAACAATTTCACACAGGA plasmid sequencing Stephan
SP6 Promoter CATACGATTTAGGTGACACTATAG plasmid sequencing Stephan
T7 Promoter 20mer TAATACGACTCACTATAGGG T3 Promoter 23mer GCAATTAACCCTCACTAAAGGGA plasmid sequencing Stephan
T7-d(T)24 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG(T)24 microarray Stephan
Personal tools