Kansai Team's Sources

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Sources)
Line 18: Line 18:
'''・Original AFM Data files'''
'''・Original AFM Data files'''
<br>
<br>
-
[[Fig. 3. AFM image of DNA origami “The Tortoise, the Hare and the ground”]]
+
[[usagi to kame.001.zip|Fig. 3. AFM image of DNA origami “The Tortoise, the Hare and the ground”]]
</div>
</div>
<br><div align="left">
<br><div align="left">

Revision as of 02:50, 2 September 2013

Sources

Top Team Project Results Protocols Sources

・Original Adobe Illustrator files of DNA origami designs



・Staples for the components

DNA usagi to kame1 TTGACCCCAAGAATAC
DNA usagi to kame2 AGAGGCAACAGCGATTATACCAAGTCGCCTGA
DNA usagi to kame3 AAAGTACAACGAAGGCACCAACCTAAAACGAA
DNA usagi to kame4 ATGCCACTTCCATTAAACGGGTAATTTTCATG
DNA usagi to kame5 AGAGGACAGTCGAAATCCGCGACCACTCATCT
DNA usagi to kame6 AGGAAGTTACGGAGATTTGTATCACGCGAAAC
DNA usagi to kame7 ATCATAAGGCCGGAAC
DNA usagi to kame8 TGCTCCATGTTACTTAGGAACCGAACTGACCAACCAGGCG
DNA usagi to kame9 TAAATTGTGAGGCTTGCAGGGAGTGATATATT
DNA usagi to kame10 AGACAGCATTGAGGACTAAAGACT
DNA usagi to kame11 CAGAGGCTTCGGAACGAGGGTAGCTCTTAAAC
DNA usagi to kame12 TTGACAAGGGCTGACCTTCATCAAGACGGTCA
DNA usagi to kame13 CGGTCGCTGATGAACGGTGTACAGACTTTGAA
DNA usagi to kame14 GCTTGCCCTCGCCCACGCATAACCTAAAGGCC
DNA usagi to kame15 GCTTTTGCGGGATCGTCACCCTCAACAATGAC
DNA usagi to kame16 ATCAGCTTACCGATAGTTGCGCCGGCAGCGAA
DNA usagi to kame17 CATAGGCTAACCGGATATTCATTAATTTCAAC
DNA usagi to kame18 AACAACCAAGGAGCCTTTAATTGTAAAAAAAG
DNA usagi to kame19 AGCTTGATGCTTTCGAGGTGAATTGAATAATA
DNA usagi to kame20 AAGAACTGTTGTGAATTACCTTATGAGTAATC
DNA usagi to kame21 GGGAAGAAGGCTTGAGATGGTTTACCCAAATC
DNA usagi to kame22 AACGTAACAAAGCTGCTCATTCAGAACGAGTA
DNA usagi to kame23 GCTCCAAATGACGAGAAACACCAGTGAATAAG
DNA usagi to kame24 GAAAGGAAACGTTGAAAATCTCCAATCGGTTT
DNA usagi to kame25 TTTAATCAGCTCATTATACCAGTCAACGAACT
DNA usagi to kame26 GTAAATTGTTTTCTGTATGGGATTGACGTTAG
DNA usagi to kame27 ATTTTTTCCAACTAAAGGAATTGCCTGTAGCA
DNA usagi to kame28 CATCAGTTAACATTATTACAGGTAGCGATTTT
DNA usagi to kame29 TAAATGAAAAATCTACGTTAATAAAGGACGTT
DNA usagi to kame30 CGAGGCATTTTTGTCGTCTTTCCATTGCTAAA
DNA usagi to kame31 CAACTTTCAACAGTTTCAGCGGAGGCGTAACG
DNA usagi to kame32 TTCCACAGACAGCCCTCATAGTTATGAGAATA
DNA usagi to kame33 AACGGAACGAGATTTAGGAATACCGACTGGAT
DNA usagi to kame34 ATCTAAAGAGTAAGAGCAACACTAACCAAAAT
DNA usagi to kame35 AATAGGAAGTACAAACTACAACGC
DNA usagi to kame36 CGTCACCACCCATGTACCGTAACAACCCTCAG
DNA usagi to kame37 TCATTGAAATACTGCGGAATCGTCGAAAGATT
DNA usagi to kame38 TCAGAAAAAATAGTAAAATGTTTAACATTCAA
DNA usagi to kame39 CTAATGCAGATACATAACGCCAAATTTTGCCA
DNA usagi to kame40 CAGGTCTTGCTTTTGCAAAAGAAGAGGAATTA
DNA usagi to kame41 GAGGGTTGATATAAGTCCAGACGACGATAAAATCATAACC
DNA usagi to kame42 CTCGTTTACTCATTTTCAGGGATACCTCAGAG
DNA usagi to kame43 GTACTCAGCCCTCAGAACCGCCACGCAAGCCC
DNA usagi to kame44 AGCGTCCATCCCCCTCAAATGCTTTAAACAGT
DNA usagi to kame45 GAGGGGGTCGAGAATGACCATAAA
DNA usagi to kame46 AGCGAGAGGGATAAGTGCCGTCGATTGCTCAG
DNA usagi to kame47 CCACCACCATAGCCCGGAATAGGTGTATCACC
DNA usagi to kame48 AACCGCCAGAGGTTTA
DNA usagi to kame49 CAAAGCGGTACCCTGACTATTATATCAAAAAT
DNA usagi to kame50 TACCAGGCTAGGATTAGCGGGGTTTCCTCAAG
DNA usagi to kame51 AGAAGGATATTGCATCAAAAAGATGTCAGAAG
DNA usagi to kame52 AGATAACCGGTAATTG
DNA usagi to kame53 AGTCAGAGGAATTAACTGAACACCAGCGCATT
DNA usagi to kame54 AATAAGAGCACAAGAATTGAGTTATATCAGAG
DNA usagi to kame55 AGACGGGAAACATAAAAACAGGGACCTTTACA
DNA usagi to kame56 GAGAGAATCAAGAAACAATGAAATAGCCCAAT
DNA usagi to kame57 CTATCTTAAAAATGAAAATAGCAGTTTTTGTT
DNA usagi to kame58 AGCAGATACCGAAGCCCTTTTTAAAGCAATAG
DNA usagi to kame59 TAACGTCACCAAATAAGAAACGATTATTATTT
DNA usagi to kame60 TTTAGCGACGGTATTC
DNA usagi to kame61 GGCTTATCATAGCAAGCAAATCAGATCATTAC
DNA usagi to kame62 GAAGCCTTACCTCCCGACTTGCGGCGAGGCGT
DNA usagi to kame63 CGCGCCCATATTTTCATCGTAGGAACAAGCAA
DNA usagi to kame64 GCCGTTTTAAATCAAGATTAGTTGGAGGTTTT
DNA usagi to kame65 CACCCAGCACCGCACTCATCGAGAGGGTATTA
DNA usagi to kame66 AACGCTAATACAATTTTATCCTGACTATTTTG
DNA usagi to kame67 AACCAAGTTTATCATTCCAAGAACAATCGGCT
DNA usagi to kame68 ACCGAGGAGCCGAACAAAGTTACCGAAAAGTA
DNA usagi to kame69 ACGAGCATCGAGCGTCTTTCCAGAATCTTACC
DNA usagi to kame70 ATCCCAATAACGCAATAATAACGGCTTATTAC
DNA usagi to kame71 GCCTAATTTGCCAGTTACAAAATAAACAGCCA
DNA usagi to kame72 GTCTTTCCGTAGAAACCAATCAATTAATGCAG
DNA usagi to kame73 ATAAAGGTTTAGCAAACGTAGAAAAGAAGGAA
DNA usagi to kame74 GACACCACGGCATGATTAAGACTCAATACCCA
DNA usagi to kame75 AAAGAACTAAAAATAATATCCCATATAAGTCC
DNA usagi to kame76 AACGCGCCTGTTTATCAACAATAGCCTAATTT
DNA usagi to kame77 GCAGTATGGGCAACATATAAAAGAGATTGAGG
DNA usagi to kame78 TGAACAAGGGAATAAGTTTATTTTCAGCGCCA
DNA usagi to kame79 GAGGGAAGGTAAATATTGACGGAAATACATAC
DNA usagi to kame80 TTTTCGAGAGGGCGACATTCAACCAACGCAAA
DNA usagi to kame81 CCGACAAAAATTCATATGGTTTACGTCACAAT
DNA usagi to kame82 CAATAGAAAAACAACATGTTCAGCTCCAGACG
DNA usagi to kame83 AAGACAAACCAGTAATAAGAGAATAACGCTCA
DNA usagi to kame84 ACGACAATAGGTAAAGTAATTCTGTGCGTTAT
DNA usagi to kame85 GCCATTTGGAATTATCACCGTCACATTATTCA
DNA usagi to kame86 TTAAAGGTCAACATGTAATTTAGGCCATATTT
DNA usagi to kame87 AGTAGCACGCTTAATTGAGAATCGCAGAGGCA
DNA usagi to kame88 TAATTACTAGAAAAAGTTACCAGTATAAAGCCATAAAGTA
DNA usagi to kame89 AACAACGCGGAATTAGAGCCAGCA
DNA usagi to kame90 ACAGTAGGATAAACACCGGAATCAAAGGCGTT
DNA usagi to kame91 ACAAATTCCCTGTTTA
DNA usagi to kame92 CGTCACCACATTACCATTAGCAAGAAATCACC
DNA usagi to kame93 AAATAAGACGACCGTGTGATAAATTAATGGTT
DNA usagi to kame94 TGAAATACATGAAACCATCGATAGGCCGGAAA
DNA usagi to kame95 AATTAATGGATATTCAACCGTTCTAGCAATAA
DNA usagi to kame96 CATTAATGAATCGGCCCCTGTCGTGCCAGCTGAGCTGATA
DNA usagi to kame97 ATCAATATCCGGAGAGGGTAGCTACTTTCCAG
DNA usagi to kame98 TCGGGAAAAACGCGCGGGGAGAGGCGGTTTGC
DNA usagi to kame99 AGATCTACAAGGCCGGAGACAGTCGGTTGTAC
DNA usagi to kame100 GTATTGGGTTGCGCTCACTGCCCGTTTTTGAG
DNA usagi to kame101 GGGTGAGAAAAGGCTATCAGGTCAACTCACAT
DNA usagi to kame102 TAATTGCGCGCCAGGGTGGTTTTTCTTTTCAC
DNA usagi to kame103 GAGTCTGGTAATGTGTAGGTAAAGCTTTTGCG
DNA usagi to kame104 CAGTGAGACCTAATGAGTGAGCTATTGCCTGA
DNA usagi to kame105 TGCCTGAGAGCAAACAAGAGAATCTGTAAAGC
DNA usagi to kame106 CTGGGGTGCGGGCAACAGCTGATTGCCCTTCA
DNA usagi to kame107 AATCAACAAACCCTCATATATTTTGGATAAAA
DNA usagi to kame108 CCGCCTGGAGCCGGAAGCATAAAGGATGAACG
DNA usagi to kame109 GTAATCGTAAAACTAGCATGTCAATTCCACAC
DNA usagi to kame110 ACCCCGGTCAATCAATATCTGGTCGAAGGTTA
DNA usagi to kame111 TCCACGCTTGTTATCCGCTCACAATCATATGT
DNA usagi to kame112 CAAACCCTTGATAATCAGAAAAGCGTTTCCTG
DNA usagi to kame113 TGTGAAATGGTTTGCCCCAGCAGGCGAAAATC
DNA usagi to kame114 CAGGAAGAATCACCTTGCTGAACCACAACTAA
DNA usagi to kame115 CTGTTTGAAATCATGGTCATAGCTCCCAAAAA
DNA usagi to kame116 TCTAAAGCTTGTATAAGCAAATATCCGAGCTC
DNA usagi to kame117 GAATTCGTTGGTGGTTCCGAAATCGGCAAAAT
DNA usagi to kame118 TAAACGTTTGAGAGCCAGCAGCAATACATTTG
DNA usagi to kame119 CCCTTATAAGAGGATCCCCGGGTATTAAATTG
DNA usagi to kame120 TGCCACGCAATATTTTGTTAAAATCCTGCAGG
DNA usagi to kame121 TCGACTCTAATCAAAAGAATAGCCCGAGATAG
DNA usagi to kame122 AATTTTTGCAGTATTAACACCGCCCAAACAAT
DNA usagi to kame123 GGTTGAGTGTGCCAAGCTTGCATGTCGCATTA
DNA usagi to kame124 GAGGCGGTTTAAATCAGCTCATTTTGTAAAAC
DNA usagi to kame125 GACGGCCAGTTGTTCCAGTTTGGAACAAGAGT
DNA usagi to kame126 ATAGGAACACCAGCAGAAGATAAAGCCCGAAC
DNA usagi to kame127 CCACTATTTTCCCAGTCACGACGTTTTAACCA
DNA usagi to kame128 AACGAACCGCCATCAAAAATAATTGGGTAACG
DNA usagi to kame129 CCAGGGTTAAAGAACGTGGACTCCAACGTCAA
DNA usagi to kame130 GCCTTCCTAAAACATCGCCATTAAAACATTAT
DNA usagi to kame131 AGGGCGAAGCAAGGCGATTAAGTTCGCGTCTG
DNA usagi to kame132 ATAGCCCTGTAGCCAGCTTTCATCGAAAGGGG
DNA usagi to kame133 GATGTGCTAAACCGTCTATCAGGGCGATGGCC
DNA usagi to kame134 ATGTGAGCTATTAGTCTTTAATGCCAGAAGGA
DNA usagi to kame135 CACTACGTTATTACGCCAGCTGGCAACATTAA
DNA usagi to kame136 TGAATGGCGAGTAACAACCCGTCGGTGCGGGC
DNA usagi to kame137 CTCTTCGCGAACCATCACCCAAATCAAGTTTT
DNA usagi to kame138 GTGGGAACAATACGTGGCACAGACTTATCAGA


・Staples for the joints

1kamehidari200 AGCCCGAAATTAAGAGGCTGAGACTCTGAAAC
1kamehidari201 ATTTTTAGAGACTTCAAATATCGCTAAGAGGA
1kamehidari204 AGCCTCAGCTTTTGATAAGAGGTC
1kamehidari205 AATTGCTCAGCATAAAGCTAAATCAAATCACC
1kamehidari206 CAAAAACAAGGTCAGGATTAGAGAGTACCTTT
1kamehidari207 ACTCCAACTTATGACCCTGTAATAATTCAAAA
1kamehidari208 GGAGAAGCCAAAGCGAACCAGACCGGAAGCAA
1kamehidari209 GTTTTAATTCGAGCTTCTTTATTTCAACGCAAAAATGCAA
1kamehidari210 ATGAAAGTGTTGAAAGGAATTGAGAGTTGGCA
1kamehidari211 TCTAAAATTTTCGGAACCTATTAT
1kamehidari212 CCTGCCTAATCTTTAGGAGCACTATCAAATAT
1kamehidari213 TAGATTAGTGCCCGTATAAACAGTTAATGCCC
1kamehidari214 AGTAACAGAGCCGTCAATAGATAAATGAAAAA
1kamehidari215 AGGATTTAAGTTTTAACGGGGTCAGTGCCTTG
1kamehidari216 TGGTAATAGAAGTATTAGACTTTATGCAACAG
1kamehidari217 TCGACAACGCTTTTGATGATACAGGAGTGTAC
1kamehidari218 CATACATGTCGTATTAAATCCTTTACAGAGGT
1kamehidari219 GTTATTAATGAATTTACCGTTCCAGTAAGCGT
1kamehidari220 GCAGTCTCTTTTAAAAGTTTGAGTAAATACCG
1kamehidari221 CATTTTGCCTCATTAAAGCCAGAATGGAAAGC
1kamehidari222 AATAAATCGGAACAAAGAAACCACGCGAACTG
1kamehidari223 GCGGAATTGATTGGCCTTGATATTCACAAACA
2kamehidari200 AGCCCGAAATTAAGAGGCTGAGACTCTGAAAC
2kamehidari201 TAGATTAGAGACTTCAAATATCGCTAAGAGGA
2kamehidari204 AGCCTCAGTCAACATGTTTTAAAT
2kamehidari205 GCTGTAGCAGCATAAAGCTAAATCAAATCACC
2kamehidari206 CAAAAACATAGAGCTTAATTGCTGAATATAAT
2kamehidari207 GGATGGCTTTATGACCCTGTAATAATTCAAAA
2kamehidari208 GGAGAAGCCTTTTGATAAGAGGTCATTTTTGC
2kamehidari209 AATTGCTCCTTTATTTCAACGCAAAAATGCAA
2kamehidari210 ATTTTTAGAGGTCAGGATTAGAGAGTACCTTT
2kamehidari211 ACTCCAACGTTGAAAGGAATTGAGAGTTGGCA
2kamehidari212 TCTAAAATCAAAGCGAACCAGACCGGAAGCAA
2kamehidari213 GTTTTAATTCGAGCTTATCTTTAGGAGCACTATCAAATAT
2kamehidari214 ATGAAAGTAGCCGTCAATAGATAAATGAAAAA
2kamehidari215 AGGATTTATTTCGGAACCTATTAT
2kamehidari216 CCTGCCTAGAAGTATTAGACTTTATGCAACAG
2kamehidari217 TCGACAACTGCCCGTATAAACAGTTAATGCCC
2kamehidari218 AGTAACAGTCGTATTAAATCCTTTACAGAGGT
2kamehidari219 GTTATTAAAGTTTTAACGGGGTCAGTGCCTTG
2kamehidari220 TGGTAATATTTTAAAAGTTTGAGTAAATACCG
2kamehidari221 CATTTTGCGCTTTTGATGATACAGGAGTGTAC
2kamehidari222 CATACATGGGAACAAAGAAACCACGCGAACTG
2kamehidari223 GCGGAATTTGAATTTACCGTTCCAGTAAGCGT
2kamehidari224 GCAGTCTCATCATCATATTCCTGAAATATTTT
2kamehidari225 TGATGGCACTCATTAAAGCCAGAATGGAAAGC
3kamehidari200 AGCCCGAAATTAAGAGGCTGAGACTCTGAAAC
3kamehidari201 TCGACAACAGACTTCAAATATCGCTAAGAGGA
3kamehidari204 AGCCTCAGATTCCCAATTCTGCGA
3kamehidari205 AACAGTTGAGCATAAAGCTAAATCAAATCACC
3kamehidari206 CAAAAACAGTGTCTGGAAGTTTCATTCCATAT
3kamehidari207 AAAGTACGTTATGACCCTGTAATAATTCAAAA
3kamehidari208 GGAGAAGCTCAACATGTTTTAAATATGCAACT
3kamehidari209 GCTGTAGCCTTTATTTCAACGCAAAAATGCAA
3kamehidari210 ATTTTTAGTAGAGCTTAATTGCTGAATATAAT
3kamehidari211 GGATGGCTGTTGAAAGGAATTGAGAGTTGGCA
3kamehidari212 TCTAAAATCTTTTGATAAGAGGTCATTTTTGC
3kamehidari213 AATTGCTCATCTTTAGGAGCACTATCAAATAT
3kamehidari214 TAGATTAGAGGTCAGGATTAGAGAGTACCTTT
3kamehidari215 ACTCCAACAGCCGTCAATAGATAAATGAAAAA
3kamehidari216 AGGATTTACAAAGCGAACCAGACCGGAAGCAA
3kamehidari217 GTTTTAATTCGAGCTTGAAGTATTAGACTTTATGCAACAG
3kamehidari218 ATGAAAGTTCGTATTAAATCCTTTACAGAGGT
3kamehidari219 GTTATTAATTTCGGAACCTATTAT
3kamehidari220 CCTGCCTATTTTAAAAGTTTGAGTAAATACCG
3kamehidari221 CATTTTGCTGCCCGTATAAACAGTTAATGCCC
3kamehidari222 AGTAACAGGGAACAAAGAAACCACGCGAACTG
3kamehidari223 GCGGAATTAGTTTTAACGGGGTCAGTGCCTTG
3kamehidari224 TGGTAATAATCATCATATTCCTGAAATATTTT
3kamehidari225 TGATGGCAGCTTTTGATGATACAGGAGTGTAC
3kamehidari226 CATACATGATTCATCAATATAATCGACCTGAA
3kamehidari227 TTGGATTATGAATTTACCGTTCCAGTAAGCGT
4kamehidari200 AGCCCGAAATTAAGAGGCTGAGACTCTGAAAC
4kamehidari201 CATTTTGCAGACTTCAAATATCGCTAAGAGGA
4kamehidari204 AGCCTCAGAACCTGTTTAGCTATA
4kamehidari205 TGGTCAATAGCATAAAGCTAAATCAAATCACC
4kamehidari206 CAAAAACATGACCATTAGATACATTTCGCAAA
4kamehidari207 ATTTAGTTTTATGACCCTGTAATAATTCAAAA
4kamehidari208 GGAGAAGCATTCCCAATTCTGCGAACGAGTAG
4kamehidari209 AACAGTTGCTTTATTTCAACGCAAAAATGCAA
4kamehidari210 ATTTTTAGGTGTCTGGAAGTTTCATTCCATAT
4kamehidari211 AAAGTACGGTTGAAAGGAATTGAGAGTTGGCA
4kamehidari212 TCTAAAATTCAACATGTTTTAAATATGCAACT
4kamehidari213 GCTGTAGCATCTTTAGGAGCACTATCAAATAT
4kamehidari214 TAGATTAGTAGAGCTTAATTGCTGAATATAAT
4kamehidari215 GGATGGCTAGCCGTCAATAGATAAATGAAAAA
4kamehidari216 AGGATTTACTTTTGATAAGAGGTCATTTTTGC
4kamehidari217 AATTGCTCGAAGTATTAGACTTTATGCAACAG
4kamehidari218 TCGACAACAGGTCAGGATTAGAGAGTACCTTT
4kamehidari219 ACTCCAACTCGTATTAAATCCTTTACAGAGGT
4kamehidari220 GTTATTAACAAAGCGAACCAGACCGGAAGCAA
4kamehidari221 GTTTTAATTCGAGCTTTTTTAAAAGTTTGAGTAAATACCG
4kamehidari222 ATGAAAGTGGAACAAAGAAACCACGCGAACTG
4kamehidari223 GCGGAATTTTTCGGAACCTATTAT
4kamehidari224 CCTGCCTAATCATCATATTCCTGAAATATTTT
4kamehidari225 TGATGGCATGCCCGTATAAACAGTTAATGCCC
4kamehidari226 AGTAACAGATTCATCAATATAATCGACCTGAA
4kamehidari227 TTGGATTAAGTTTTAACGGGGTCAGTGCCTTG
4kamehidari228 TGGTAATATACTTCTGAATAATGGGACATTCT
4kamehidari229 GAACCTACGCTTTTGATGATACAGGAGTGTAC
5kamehidari200 AGCCCGAAATTAAGAGGCTGAGACTCTGAAAC
5kamehidari201 TGATGGCAAGACTTCAAATATCGCTAAGAGGA
5kamehidari204 AGCCTCAGGTAGTAGCATTAACAT
5kamehidari205 TACTAATAAGCATAAAGCTAAATCAAATCACC
5kamehidari206 CAAAAACAGAGCTGAAAAGGTGGCATCAATTC
5kamehidari207 TGGGGCGCTTATGACCCTGTAATAATTCAAAA
5kamehidari208 GGAGAAGCAACCTGTTTAGCTATATTTTCATT
5kamehidari209 TGGTCAATCTTTATTTCAACGCAAAAATGCAA
5kamehidari210 ATTTTTAGTGACCATTAGATACATTTCGCAAA
5kamehidari211 ATTTAGTTGTTGAAAGGAATTGAGAGTTGGCA
5kamehidari212 TCTAAAATATTCCCAATTCTGCGAACGAGTAG
5kamehidari213 AACAGTTGATCTTTAGGAGCACTATCAAATAT
5kamehidari214 TAGATTAGGTGTCTGGAAGTTTCATTCCATAT
5kamehidari215 AAAGTACGAGCCGTCAATAGATAAATGAAAAA
5kamehidari216 AGGATTTATCAACATGTTTTAAATATGCAACT
5kamehidari217 GCTGTAGCGAAGTATTAGACTTTATGCAACAG
5kamehidari218 TCGACAACTAGAGCTTAATTGCTGAATATAAT
5kamehidari219 GGATGGCTTCGTATTAAATCCTTTACAGAGGT
5kamehidari220 GTTATTAACTTTTGATAAGAGGTCATTTTTGC
5kamehidari221 AATTGCTCTTTTAAAAGTTTGAGTAAATACCG
5kamehidari222 CATTTTGCAGGTCAGGATTAGAGAGTACCTTT
5kamehidari223 ACTCCAACGGAACAAAGAAACCACGCGAACTG
5kamehidari224 GCGGAATTCAAAGCGAACCAGACCGGAAGCAA
5kamehidari225 GTTTTAATTCGAGCTTATCATCATATTCCTGAAATATTTT
5kamehidari226 ATGAAAGTATTCATCAATATAATCGACCTGAA
5kamehidari227 TTGGATTATTTCGGAACCTATTAT
5kamehidari228 CCTGCCTATACTTCTGAATAATGGGACATTCT
5kamehidari229 GAACCTACTGCCCGTATAAACAGTTAATGCCC
5kamehidari230 AGTAACAGCATATCAAAATTATTTGATTCACC
5kamehidari231 AACAGAAAAGTTTTAACGGGGTCAGTGCCTTG
1usagimigi202 TAATCAGTTCTTCTGACCTAAATTATTTTAGT
1usagimigi203 AACAGAAAAGCGACAGAATCAAGTCAGCACCG
1usagimigi220 CCCTCAGATTTTAAAAGTTTGAGTAAATACCG
1usagimigi221 CATTTTGCGAACCGCCACCCTCAGAGCCACCA
1usagimigi222 CACCCTCAGGAACAAAGAAACCACGCGAACTG
1usagimigi223 GCGGAATTCGGAACCGCCTCCCTCAGAGCCGC
1usagimigi224 GCCACCACATCATCATATTCCTGAAATATTTT
1usagimigi225 TGATGGCAATAATCAAAATCACCGGAACCAGA
1usagimigi226 ATCTTTTCATTCATCAATATAATCGACCTGAA
1usagimigi227 TTGGATTAATAGCCCCCTTATTAGCGTTTGCC
1usagimigi228 TTTCGGTCTACTTCTGAATAATGGGACATTCT
1usagimigi229 GAACCTACACTGTAGCGCGTTTTCATCGGCAT
1usagimigi230 TTGCCTTTAGCGTCAGCATATCAAAATTATTTGATTCACC
1usagimigi231 TAATTTCATAAAGAAATTGCGTAGCAATCGTC
1usagimigi232 GTTTAACGAAACTTTTTCAAATAT
1usagimigi233 ACGCGAGATCAGATGAATATACAGAACGCTCA
1usagimigi234 CCTTTTACGCAAATCCAATCGCAAGACAAAGA
1usagimigi235 ATGCTGATATCGGGAGAAACAATAACAATATT
1usagimigi236 GCCTGATTGTTGGGTTATATAACTATATGTAA
1usagimigi237 TTAACCTCCGGCTTAGGCTTTGAATACCAAGTTCAAACTA
2usagimigi202 TAATCAGTTCTTCTGACCTAAATTATTTTAGT
2usagimigi203 TTGGATTAAGCGACAGAATCAAGTCAGCACCG
2usagimigi218 CACCCTCATCGTATTAAATCCTTTACAGAGGT
2usagimigi219 GTTATTAACGGAACCGCCTCCCTCAGAGCCGC
2usagimigi220 GCCACCACTTTTAAAAGTTTGAGTAAATACCG
2usagimigi221 CATTTTGCATAATCAAAATCACCGGAACCAGA
2usagimigi222 ATCTTTTCGGAACAAAGAAACCACGCGAACTG
2usagimigi223 GCGGAATTATAGCCCCCTTATTAGCGTTTGCC
2usagimigi224 TTTCGGTCATCATCATATTCCTGAAATATTTT
2usagimigi225 TGATGGCAACTGTAGCGCGTTTTCATCGGCAT
2usagimigi226 TTGCCTTTAGCGTCAGATTCATCAATATAATCGACCTGAA
2usagimigi227 TAATTTCATACTTCTGAATAATGGGACATTCT
2usagimigi228 GAACCTACAAACTTTTTCAAATAT
2usagimigi229 ACGCGAGACATATCAAAATTATTTGATTCACC
2usagimigi230 AACAGAAAGCAAATCCAATCGCAAGACAAAGA
2usagimigi231 ATGCTGATTAAAGAAATTGCGTAGCAATCGTC
2usagimigi232 GTTTAACGGTTGGGTTATATAACTATATGTAA
2usagimigi233 CGGCTTAGTCAGATGAATATACAGAACGCTCA
2usagimigi234 CCTTTTACCTGAGAGACTACCTTTTTAACCTC
2usagimigi235 TCATAGGTATCGGGAGAAACAATAACAATATT
2usagimigi236 GCCTGATTGAGTCAATAGTGAATTTATCAAAA
2usagimigi237 ATTAAGACGCTGAGAAGCTTTGAATACCAAGTTCAAACTA
3usagimigi202 TAATCAGTTCTTCTGACCTAAATTATTTTAGT
3usagimigi203 GCGGAATTAGCGACAGAATCAAGTCAGCACCG
3usagimigi216 GCCACCACGAAGTATTAGACTTTATGCAACAG
3usagimigi217 TCGACAACATAATCAAAATCACCGGAACCAGA
3usagimigi218 ATCTTTTCTCGTATTAAATCCTTTACAGAGGT
3usagimigi219 GTTATTAAATAGCCCCCTTATTAGCGTTTGCC
3usagimigi220 TTTCGGTCTTTTAAAAGTTTGAGTAAATACCG
3usagimigi221 CATTTTGCACTGTAGCGCGTTTTCATCGGCAT
3usagimigi222 TTGCCTTTAGCGTCAGGGAACAAAGAAACCACGCGAACTG
3usagimigi223 TAATTTCAATCATCATATTCCTGAAATATTTT
3usagimigi224 TGATGGCAAAACTTTTTCAAATAT
3usagimigi225 ACGCGAGAATTCATCAATATAATCGACCTGAA
3usagimigi226 TTGGATTAGCAAATCCAATCGCAAGACAAAGA
3usagimigi227 ATGCTGATTACTTCTGAATAATGGGACATTCT
3usagimigi228 GAACCTACGTTGGGTTATATAACTATATGTAA
3usagimigi229 CGGCTTAGCATATCAAAATTATTTGATTCACC
3usagimigi230 AACAGAAACTGAGAGACTACCTTTTTAACCTC
3usagimigi231 TCATAGGTTAAAGAAATTGCGTAGCAATCGTC
3usagimigi232 GTTTAACGGAGTCAATAGTGAATTTATCAAAA
3usagimigi233 GCTGAGAATCAGATGAATATACAGAACGCTCA
3usagimigi234 CCTTTTACCATAGCGATAGCTTAGATTAAGAC
3usagimigi235 CTTGAAAAATCGGGAGAAACAATAACAATATT
3usagimigi236 GCCTGATTATTAATTAATTTTCCCTTAGAATC
3usagimigi237 TCTGTAAATCGTCGCTGCTTTGAATACCAAGTTCAAACTA
4usagimigi202 TAATCAGTTCTTCTGACCTAAATTATTTTAGT
4usagimigi203 GTTATTAAAGCGACAGAATCAAGTCAGCACCG
4usagimigi214 ATCTTTTCAGCCGTCAATAGATAAATGAAAAA
4usagimigi215 AGGATTTAATAGCCCCCTTATTAGCGTTTGCC
4usagimigi216 TTTCGGTCGAAGTATTAGACTTTATGCAACAG
4usagimigi217 TCGACAACACTGTAGCGCGTTTTCATCGGCAT
4usagimigi218 TTGCCTTTAGCGTCAGTCGTATTAAATCCTTTACAGAGGT
4usagimigi219 TAATTTCATTTTAAAAGTTTGAGTAAATACCG
4usagimigi220 CATTTTGCAAACTTTTTCAAATAT
4usagimigi221 ACGCGAGAGGAACAAAGAAACCACGCGAACTG
4usagimigi222 GCGGAATTGCAAATCCAATCGCAAGACAAAGA
4usagimigi223 ATGCTGATATCATCATATTCCTGAAATATTTT
4usagimigi224 TGATGGCAGTTGGGTTATATAACTATATGTAA
4usagimigi225 CGGCTTAGATTCATCAATATAATCGACCTGAA
4usagimigi226 TTGGATTACTGAGAGACTACCTTTTTAACCTC
4usagimigi227 TCATAGGTTACTTCTGAATAATGGGACATTCT
4usagimigi228 GAACCTACGAGTCAATAGTGAATTTATCAAAA
4usagimigi229 GCTGAGAACATATCAAAATTATTTGATTCACC
4usagimigi230 AACAGAAACATAGCGATAGCTTAGATTAAGAC
4usagimigi231 CTTGAAAATAAAGAAATTGCGTAGCAATCGTC
4usagimigi232 GTTTAACGATTAATTAATTTTCCCTTAGAATC
4usagimigi233 TCGTCGCTTCAGATGAATATACAGAACGCTCA
4usagimigi234 CCTTTTACAGTGAATAACCTTGCTTCTGTAAA
4usagimigi235 TATATGTGATCGGGAGAAACAATAACAATATT
4usagimigi236 GCCTGATTTAATGGAAACAGTACATAAATCAA
4usagimigi237 TTTGAATTACCTTTTTGCTTTGAATACCAAGTTCAAACTA
5usagimigi202 TAATCAGTTCTTCTGATTTTAGT
5usagimigi203 AGGATTTAAGCGACAGAATCAAGTCAGCACCG
5usagimigi212 TTTCGGTCATCTTTAGGAGCACTATCAAATAT
5usagimigi213 TAGATTAGACTGTAGCGCGTTTTCATCGGCAT
5usagimigi214 TTGCCTTTAGCGTCAGAGCCGTCAATAGATAAATGAAAAA
5usagimigi215 TAATTTCAGAAGTATTAGACTTTATGCAACAG
5usagimigi216 TCGACAACAAACTTTTTCAAATAT
5usagimigi217 ACGCGAGATCGTATTAAATCCTTTACAGAGGT
5usagimigi218 GTTATTAAGCAAATCCAATCGCAAGACAAAGA
5usagimigi219 ATGCTGATTTTTAAAAGTTTGAGTAAATACCG
5usagimigi220 CATTTTGCGTTGGGTTATATAACTATATGTAA
5usagimigi221 CGGCTTAGGGAACAAAGAAACCACGCGAACTG
5usagimigi222 GCGGAATTCTGAGAGACTACCTTTTTAACCTC
5usagimigi223 TCATAGGTATCATCATATTCCTGAAATATTTT
5usagimigi224 TGATGGCAGAGTCAATAGTGAATTTATCAAAA
5usagimigi225 GCTGAGAAATTCATCAATATAATCGACCTGAA
5usagimigi226 TTGGATTACATAGCGATAGCTTAGATTAAGAC
5usagimigi227 CTTGAAAATACTTCTGAATAATGGGACATTCT
5usagimigi228 GAACCTACATTAATTAATTTTCCCTTAGAATC
5usagimigi229 TCGTCGCTCATATCAAAATTATTTGATTCACC
5usagimigi230 AACAGAAAAGTGAATAACCTTGCTTCTGTAAA
5usagimigi231 TATATGTGTAAAGAAATTGCGTAGCAATCGTC
5usagimigi232 GTTTAACGTAATGGAAACAGTACATAAATCAA
5usagimigi233 ACCTTTTTTCAGATGAATATACAGAACGCTCA
5usagimigi234 CCTTTTACACATTTAACAATTTCATTTGAATT
5usagimigi235 AATTAATTATCGGGAGAAACAATAACAATATT
5usagimigi236 GCCTGATTATGAAACAAACATCAAGAAAACAA
5usagimigi237 TGAGCAAAAGAAGATGGCTTTGAATACCAAGTTCAAACTA
DNA usagi to kame35DB TCCTCTTTTGAGGAACAAGTTTTCTTGTAATAGGAAGTACAAACTACAACGC
DNA usagi to kame70DB ATCCCAATAACGCAATAATAACGGCTTATTACTCCTCTTTTGAGGAACAAGTTTTCTTGT
DNA usagi to kame76DB GCAGTATGGGCAACATTCCTCTTTTGAGGAACAAGTTTTCTTGTATAAAAGAGATTGAGG
DNA usagi to kame77DB AACGCGCCTGTTTATCTCCTCTTTTGAGGAACAAGTTTTCTTGTAACAATAGCCTAATTT
DNA usagi to kame81DB TCCTCTTTTGAGGAACAAGTTTTCTTGTCCGACAAAAATTCATATGGTTTACGTCACAAT

Personal tools