Knight:Evolving Reshmaverters/Promoter library design

Promoter library design

In progress!

Promoter architecture

                 -35                    -10        +1
                ______                 ______       _
----------------TTGACA-----------------TATAAT----- CA------------------- (consensus)
----------------TTGCTT-----------------TATAAT-GATT CATAAATTTGAGAGAGGAGTT (good promoter clearance?) [1]
----------------TTGACT-----------------GATACT------CA------------------- (repressible, low KON?)[2]

Constant promoter

                 -35                    -10        +1
                ______                 ______       _
TTTATCAAAAAGAGTGTTGACTTAAAATcccacgcgtggGATACTTAGATTCATAAATTTGAGAGAGGAGTT (novel promoter design for RBS screen)

Questions

1. Is this promoter too strong? Near consensus -35 and -10 with a TG dinucleotide at -14.
2. Do I include too much extraneous sequence? These promoters are longer to reflect those found in papers.

Libraries

                 -35                    -10        +1
                ______                 ______       _
TTTATCAAAAAGAGTGTTGNNNnnnnnncccacgcgtggGATANTTAGATTCATAAATTTGAGAGAGGAGTT (screen -35 and -10, 12bp operator)
TTTATCAAAAAGAGTGTTGNNNnnnncccacgcgcgtggGATANTTAGATTCATAAATTTGAGAGAGGAGTT (screen -35 and -10, 14bp operator)
TTTATCAAAAAGAGTGTTGNNNnnnnnncccacgcgtggGATANTTAGAcccacgcgtggGAGAGAGGAGTT (screen -35 and -10, 12bp operator in two locations)

Operator

 0 site operator: cccacgcgcgtggg (14bp)
-2 site operator: cccacgc  gtggg (12bp) (higher affinity)

Brainstorming

How could these regulatory regions be redesigned to be repressible?

Comments welcome

• Repressor sites tend to fall between the -35 and -10 regions and/or downstream of the -10 (around the +1). (Not upstream of the -35). [3, 4]
• Binding of the repressor dimer to the promoter may lead to DNA bending rendering binding of more dimers unfavorable. Perhaps a single binding site is preferable?
• The TG sequence at -16 is causing the regulatory regions to be too strong in the derepressed state. The RNA polymerase is "winning" the competition for binding with the repressor. Perhaps this dinucleotide should be removed. [5, 6]
• A high k_ON (rate of complex formation between RNA polymerase and promoter) correlates inversely with repressibility. High k_ON may result in RNAP outcompeting the repressor for the regulatory region binding. High regulatory region clearance rates enable strong transcription initiation and allow for repressor binding.[2]
• +1 base should be an A with 6-7 bases between end of -10 hexamer and +1. [1, 2]
• Use the -2 operator site because it binds the homodimer more tightly. (But it is less modular).

• How can we design promoters with low k_ON but high clearance rates for improved repressibility?
  • K_ON and promoter occupancy by RNAP is determined by the -35 and -10 hexaners. Closer to consensus sequences means high k_ON and more stable RNAP-promoter complexes. [7]
  • An AT rich region around the transcription start site may lead to better promoter clearance? [1, 7]

Existing promoters

The following promoters have been tested and are not repressible under my testing conditions.

Heterodimers:
                         -35                    -10
Promoter1 cacgtgtgcgtgggTTGACAcgtgtgcgtgggaagtcGATACTgagcaca
Promoter2*              TTGACAcgtgtgcgtgggaagtcGATACTtagattcacgtgtgcgtggg
Promoter3 cacgtgtgcgtgggTTGACAcgtgtgcgtgggaagtcGATACTtagattcacgtgtgcgtggg
Promoter4 cacgtgtgcgtgggTTGACAcacgtgtgcgtgggaatGATACTgagcaca
Promoter5               TTGACAcacgtgtgcgtgggaatGATACTtagattcacgtgtgcgtggg
Promoter6 cacgtgtgcgtgggTTGACAcacgtgtgcgtgggaatGATACTtagattcacgtgtgcgtggg

Homodimers:
                    -35                   -10
BBa_R2000 agtttattcTTGACAtggtcccacgcgcgtggGATACTacgtcag
BBa_R2001 agtttattcTTGACAtggtcatattacggtgaGATACTcccacgcgcgtggg
BBa_R2002 agtttattcTTGACAtggtcccacgcgcgtggGATACTcccacgcgcgtggg

Relevant work

1. Kammerer W, Deuschle U, Gentz R, and Bujard H. Functional dissection of Escherichia coli promoters: information in the transcribed region is involved in late steps of the overall process. EMBO J. 1986 Nov;5(11):2995-3000. DOI:10.1002/j.1460-2075.1986.tb04597.x |
2. Lanzer M and Bujard H. Promoters largely determine the efficiency of repressor action. Proc Natl Acad Sci U S A. 1988 Dec;85(23):8973-7. DOI:10.1073/pnas.85.23.8973 |
3. Collado-Vides J, Magasanik B, and Gralla JD. Control site location and transcriptional regulation in Escherichia coli. Microbiol Rev. 1991 Sep;55(3):371-94. DOI:10.1128/mr.55.3.371-394.1991 |
4. Gralla JD. Transcriptional control--lessons from an E. coli promoter data base. Cell. 1991 Aug 9;66(3):415-8. DOI:10.1016/0092-8674(81)90001-5 |
5. Burr T, Mitchell J, Kolb A, Minchin S, and Busby S. DNA sequence elements located immediately upstream of the -10 hexamer in Escherichia coli promoters: a systematic study. Nucleic Acids Res. 2000 May 1;28(9):1864-70. DOI:10.1093/nar/28.9.1864 |
6. Voskuil MI, Voepel K, and Chambliss GH. The -16 region, a vital sequence for the utilization of a promoter in Bacillus subtilis and Escherichia coli. Mol Microbiol. 1995 Jul;17(2):271-9. DOI:10.1111/j.1365-2958.1995.mmi_17020271.x |
7. Ellinger T, Behnke D, Bujard H, and Gralla JD. Stalling of Escherichia coli RNA polymerase in the +6 to +12 region in vivo is associated with tight binding to consensus promoter elements. J Mol Biol. 1994 Jun 17;239(4):455-65. DOI:10.1006/jmbi.1994.1388 |
8. Lutz R and Bujard H. Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. DOI:10.1093/nar/25.6.1203 |
9. Besse M, von Wilcken-Bergmann B, and Müller-Hill B. Synthetic lac operator mediates repression through lac repressor when introduced upstream and downstream from lac promoter. EMBO J. 1986 Jun;5(6):1377-81. DOI:10.1002/j.1460-2075.1986.tb04370.x |