Koch Lab:Protocols/Unzipping constructs/17mer/Adapter duplex
From OpenWetWare
(→Oligo resuspension buffer) |
(→Resuspend Oligos) |
||
| Line 46: | Line 46: | ||
===Resuspend Oligos=== | ===Resuspend Oligos=== | ||
| + | |||
| + | Resuspend oligos in oligo resuspension buffer (such as 0.1x TE buffer). Use an appropriate volume so that based on the certificate of analysis sent with oligos you will end up with about 100 micromolar of oligo. | ||
| + | |||
| + | Assess actual concentration using a spectrophotometer and look at the whole scan from UV through 500 or so nm. If there are impurities in the oligo preparation (as we have seen with some companies, and particularly dig-modified oligos, this may show up in the absorption scan). Calculate the actual concentration, and use this in subsequent calculations. This isn't an exact measure of concentration -- a better and easier method would be good, as we would like to have equimolar concentration of oligos in the annealing step. | ||
===Anneal duplexes=== | ===Anneal duplexes=== | ||
Revision as of 16:25, 15 June 2008
| Home | Research | Lab Members | Publications | Protocols | Contact | Funding |
| Principles | Data | Notebooks | Links | Meetings | Presentations | Inventory |
Contents |
Overview
The purpose of the adapter duplex (aka "insert duplex") is:
- Provide the final essential components for unzipping: an internal nick (missing covalent bond) and a biotin label.
- Provide another sticky end for ligation of downstream unzipping segment
There are a variety of ways this can be achieved. The specific implementation here seemed to work well.
Legacy
We switched to this method after having some issues with a "fork unzipping construct". The method is adapted from Heslot, Essevaz-Roulet, Bockelmann 1997 method. One difference from that method is the biotin is internal to the duplex, as opposed to a dangling end of DNA. We chose to do this so the T4 DNA ligase would be "happy", as the DNA can form a nice hybrid and the biotin is far enough away to not affect ligase. We don't really know whether this would have been an issue, but the design ended up having a nice feature: unzipping commences with an initial moderate-force shearing event. This serves as a very nice landmark in the force-extension data.
Also, when using downstream unzipping segment to study site-specific DNA binding proteins, you should probably design the adapter insert to not have those binding sites.
Alternatives
In this protocol, we are using the adapter duplex as just a way of connecting the anchoring segment to the downstream unzipping segment, while providing a nick and a biotin label. So, we don't care much about the DNA content of the duplex. However, there are a lot of opportunities for putting the science directly into the adapter insert, and forgetting about the downstream segment altogether. One could do this with even an adapter hairpin (so that unzipping doesn't break, but results in a completely single-stranded reversible strand). In doing so, one would want to add length to the duplex (probably) and binding sites of interest. Constructing something like this would be a lot easier than the full 17-mer unzipping construct we're describing in this protocol. (But 17-mer repetitive DNA has a lot of advantages.)
Materials
Oligonucleotides
Pay special attention to presence or absence of 5' phosphate on these oligos
- 17mer Adapter I -- overhang
- 5’-P-GCTGTCTGAATTCTAATGTAGTATAGTAATCCGCTCATCG
- Modifications: 5' phosphate
- Overhangs (sticky ends) are in bold above
- 17mer Adapter II -- biotin underhang
- 5'-GAGCGGAT(6)ACTATACTACATTAGAATTCAGAC
- (6) = biotin-dT modification
- NO 5' phosphate
Steve recommends Alpha DNA for the oligos. See Koch_Lab:Protocols/Unzipping_constructs/17mer/Anchoring_segment#Primers.
Oligo resuspension buffer
Many different buffers will work. Try 0.1x TE buffer.
Oligo annealing buffer
Procedure
Resuspend Oligos
Resuspend oligos in oligo resuspension buffer (such as 0.1x TE buffer). Use an appropriate volume so that based on the certificate of analysis sent with oligos you will end up with about 100 micromolar of oligo.
Assess actual concentration using a spectrophotometer and look at the whole scan from UV through 500 or so nm. If there are impurities in the oligo preparation (as we have seen with some companies, and particularly dig-modified oligos, this may show up in the absorption scan). Calculate the actual concentration, and use this in subsequent calculations. This isn't an exact measure of concentration -- a better and easier method would be good, as we would like to have equimolar concentration of oligos in the annealing step.
Anneal duplexes
Storage and handling
Store in 0.5 ml annealing tube. Freeze thaw cycles should not be an issue, but try not to bring too far above 4C when thawing.


