Koch Lab:Protocols/Unzipping constructs/17mer/Adapter duplex
From OpenWetWare
Add to My Links| Home | Research | Lab Members | Publications | Protocols | Contact | Funding |
| Principles | Data | Notebooks | Links | Meetings | Presentations | Inventory |
Contents |
Overview
The purpose of the adapter duplex (aka "insert duplex") is:
- Provide the final essential components for unzipping: an internal nick (missing covalent bond) and a biotin label.
- Provide another sticky end for ligation of downstream unzipping segment
There are a variety of ways this can be achieved. The specific implementation here seemed to work well.
Legacy
We switched to this method after having some issues with a "fork unzipping construct". The method is adapted from Heslot, Essevaz-Roulet, Bockelmann 1997 method. One difference from that method is the biotin is internal to the duplex, as opposed to a dangling end of DNA. We chose to do this so the T4 DNA ligase would be "happy", as the DNA can form a nice hybrid and the biotin is far enough away to not affect ligase. We don't really know whether this would have been an issue, but the design ended up having a nice feature: unzipping commences with an initial moderate-force shearing event. This serves as a very nice landmark in the force-extension data.
Also, when using downstream unzipping segment to study site-specific DNA binding proteins, you should probably design the adapter insert to not have those binding sites.
Alternatives
In this protocol, we are using the adapter duplex as just a way of connecting the anchoring segment to the downstream unzipping segment, while providing a nick and a biotin label. So, we don't care much about the DNA content of the duplex. However, there are a lot of opportunities for putting the science directly into the adapter insert, and forgetting about the downstream segment altogether. One could do this with even an adapter hairpin (so that unzipping doesn't break, but results in a completely single-stranded reversible strand). In doing so, one would want to add length to the duplex (probably) and binding sites of interest. Constructing something like this would be a lot easier than the full 17-mer unzipping construct we're describing in this protocol. (But 17-mer repetitive DNA has a lot of advantages.)
Materials
Oligonucleotides
Pay special attention to presence or absence of 5' phosphate on these oligos
- 17mer Adapter I -- overhang
- 5’-P-GCTGTCTGAATTCTAATGTAGTATAGTAATCCGCTCATCG
- Modifications: 5' phosphate
- 17mer Adapter II -- biotin underhang
- 5'-GAGCGGAT(6)ACTATACTACATTAGAATTCAGAC
- (6) = biotin-dT modification
- NO 5' phosphate
Oligo resuspension buffer
Oligo annealing buffer
Procedure
Resuspend Oligos
Anneal duplexes
Storage and handling
Store in 0.5 ml annealing tube. Freeze thaw cycles should not be an issue, but try not to bring too far above 4C when thawing.


