M13 redesign, expt'l details

User:Nkuldell:M13 redesign

Vectors

M13K07 plasmid map, from NEB

• M13KE [[1]]
• pUC118 [[2]] or 119 [[3]]
• M13K07 (helper phage)[|sequence][[4]]

File:M13KO7 zerocutters.txt
File:M13KO7 singlecutters.txt
File:M13KO7 2cutters.txt

Possible M13K07 edits

Sequence	code on plasmid map	edit
PS (packing sequence)	?	?
bact ori	"e"	to pSCAN ori
gII and gX	"c" and "g"	unstuff
gV	"i"	different ssBP
gVII	"k"	add loop to be presented on phage head
gIX and gVIII	"l" and "j"	remove overlap of gIX stop with gVIII start
gVIII and gIII	"j" and "b"	add epitope tags
gVI	"f"	add loop to be presented on phage tail
gI and gXI	"d" and "h"	unstuff, and/or add aa substitutions to make maturation PS-indep
gIV	"a"	titrate promoter to vary pore concentration

Primers

For M13K07 manipulations

• First need to delete Pst site from M13K07 polylinker

these oligos should both destroy Pst and add unique EcoRI to position 8083

• NO133: ChangePst2RI_top
  
  • 5'ATAG AAT TCT ATG CA
• NO134: ChangePst2RI_btm
  
  • 5'ACG TTAT CTT AAG AT
    
• Next step is to add PstI to Petrenko site

use site directed mutagenesis to change GCT to GCA (silent change at Ala, first residue in mature protein)

• NO135: AddPst2gVIII_fwd
  
  • CGT TCCGATGCTG TCTTTCGCTG CaGAGGGTGA CGATCCCGCA AAAGCGGCC
  • Tm 74°
• NO136: AddPst2gVIII_rev
  • GGC CGC TTT TGC GGG ATC GTC ACC CTC TGC AGC GAA AGA CAG CAT CGG AAC G
  • Tm 74°

For M13K07 sequencing

• NO137: M13KO7_seq1100_fwd
  • TAAGTAACATG GAGCAGGTCG CGGATTTCGA CAC
  • Tm 65°

Epitope Tagging

[general info about epitope tagging with PCR]
[genetic code]
[RE finder to help with primer design]
Generalize instructions as:

• reverse translate epitope
• add overhangs for cloning
• check reading frame
• add RE site either via silent changes or to restore reading frame or by adding aa

g8p

File:Macintosh HD-Users-nkuldell-Desktop-g8p M13K07+Pst.doc [UniprotKB entry]
Insert tag at Pst in g8p M13K07 after SDM with NO135/136

• HA
  • 9-amino acid sequence (YPYDVPDYA) recognized by the anti-12CA5 (=anti-HA)
  • reverse translate at [|Gene Design]
  • default settings gives sequence: TACCCATATGATGTTCCGGACTACGCT
  • add silent restriction sites. Considered all degeneracies of codons, found can silently insert AatII in middle of tag as: TACCCATATGAcGTcCCGGACTACGCa gives AatII site which is not naturally in M13KO7.
    • alternatively add Val to N-term end of tag where val tyr encoded by GTA TAC = unique BstZ171 site
    • alternatively add Ser to C-term end of tag so prot seq reads:...asp tyr ala ser cys...where ala ser encoded by GCT AGC = unique NheI site
  • add Pst tails for ligation, using last t of Ala codon as first base for Pst overhang...this requires that the bottom primer not base pair to that position.
    • NO140 g8p_HA_top: TAC CCA TAT GAC GTC CCG GAC TAC GCt gca
    • NO141 g8p_HA_btm: acgt ATG GGT ATA CTG CAG GGC CTG ATG CG
    • resulting tag is 10aa (9aaHA+Ala) then back in frame with g8 seq at Glu25

• c-myc
  • 10-amino acid sequence (EQKLISEEDL) recognized by anti-9E10 (=anti-myc)
  • reverse translate at [|Gene Design]
  • default settings gives sequence: GAACAGAAACTGATCTCTGAAGAAGACCTG
  • add silent restriction site. Considered all degeneracies of codons, found can silently insert HindIII in middle of tag as: GAACAGAAgCTtATCTCTGAAGAAGACCTG

(there is second HindIII in M13K07 at 7402, so construct with insert should give fragment plus bkb.

• • add Pst tails for ligation using last t of Leu codon as first base for Pst overhang...this requires that the bottom primer not base pair to that position.
    • NO142 g8p_myc_top: GAA CAG AAg CTt ATC TCT GAA GAA GAC CTt gca
    • NO143 g8p_myc_btm: acgt CTT GTC TTC GAA TAG AGA CTT CTT CTG GA
    • resulting tag is 11aa (10aa c-myc+Ala) then back in frame with g8 seq at Glu25

g3p

File:Macintosh HD-Users-nkuldell-Desktop-g3p M13KO7translated.doc [UniProtKB entry]
Insert tag at natural unique BamHI in g3p M13K07.
For consistency used version after SDM with NO135/136 but if these silent changes attenuate phage, may want to try in wtM13KO7
Note from CN at NEB 11.1.06:
The Bam site in wt M13 (and M13KO7) overlaps residues 196-198 of pIII, which fall in the domain (D2) which is involved in F-pilus binding (i.e. the first step in phage infection). Deng and Perham (J Mol Biol 319, 603-614, 2002) characterized a series of mutants to delineate the precise F-pilus binding site of D2, and found that the interaction occurs at a loop comprising residues 178-199, which happens to contain the BamHI site. The good news is that this is a solvent-exposed loop; the bad news is that insertions here might disrupt F-pilus binding, resulting in non-infectious phage. (FYI, in the mp versions of M13, and our PhD cloning vector M13KE, the 2 C's in the Bam site are replaced by T's, resulting in Pro198 being Leu, which has no effect on phage infectivity.) So the short answer is that while there are good reasons to expect that insertions at the Bam site would not be tolerated, you might want to try it anyway.

• HA
  • 9-amino acid sequence (YPYDVPDYA) recognized by the anti-12CA5 (=anti-HA)
  • reverse translate at [|Gene Design]
  • default settings gives sequence: TACCCATATGATGTTCCGGACTACGCT
  • add silent restriction site: TACCCATATGAcGTcCCGGACTACGCT gives AatII site which is not naturally in M13KO7.
  • add Bam tails for ligation, changing last T of Ala codon to G (also Ala) as first base for Bam overhang...this requires that the top primer not base pair to that position.
    • NO144 g3p_HA_top: gat cca TAC CCA TAT GAC GTC CCG GAC TAC GC
    • NO145 g3p_HA_btm: gt ATG GGT ATA CTG CAG GGC CTG ATG CGc tag
    • resulting tag starts after g3 Pro216, inserting 10aa (9aaHA+Ile) then back in frame with g3 seq at Phe217

• c-myc
  • 10-amino acid sequence (EQKLISEEDL) recognized by anti-9E10 (=anti-myc)
  • reverse translate at [|Gene Design]
  • default settings gives sequence: GAACAGAAACTGATCTCTGAAGAAGACCTG
  • add silent restriction site. Considered all degeneracies of codons, found can silently insert HindIII in middle of tag as: GAACAGAAgCTtATCTCTGAAGAAGACCTG

(there is second HindIII in M13K07 at 7402, so construct with insert should give fragment plus bkb.

• • add Bam tails for ligation, removing last G of Leu codon from top primer to use as first base for Bam overhang, followed by unpaired TAG on bottom primer for Bam site. This inserts Ile into tag.
    • NO146 g3p_myc_top: gat cca GAA CAG AAg CTt ATC TCT GAA GAA GAC CT
    • NO147 g3p_myc_btm: gt CTT GTC TTC GAA TAG AGA CTT CTT CTG GAc tag
    • resulting tag starts after g3 Pro216, inserting 11aa (10aa c-myc+Ile) then back in frame with g3 seq at Phe217