Making construction plasmid: Difference between revisions
No edit summary |
No edit summary |
||
| Line 1: | Line 1: | ||
''Construction plasmid'' is pre-cut backbone plasmid DNA from the three different plasmid backbones used for three antibiotic assembly (pSB1AC3, pSB1AK3, and pSB1AT3). It is cut with EcoRI and PstI, and ready for use in three way ligation reactions. Ideally, it is free of inserts and uncut plasmid. There are several ways to make construction plasmids. Our original approach was to use plasmid containing the P1010 insert, coding for the ccdB protein generator. This protein product is toxic to cells not having the gyrA462 mutation (most strains except for DB3.1). As a result, uncut or religated plasmid would produce little background. In our experience, this approach has a number of difficulties. Extraction of cut backbone from inserts required the use of gel purification, which is difficult with high concentrations of DNA, and problematic in yield and quality. The P1010 insert also showed remarkable ability to mutate (usually by frame shift) to a form not toxic to normal cells, leading to significant background. | '''Construction plasmid''' is pre-cut backbone plasmid DNA from the three different plasmid backbones used for three antibiotic assembly (pSB1AC3, pSB1AK3, and pSB1AT3). It is cut with EcoRI and PstI, and ready for use in three way ligation reactions. Ideally, it is free of inserts and uncut plasmid. There are several ways to make construction plasmids. Our original approach was to use plasmid containing the P1010 insert, coding for the ccdB protein generator. This protein product is toxic to cells not having the gyrA462 mutation (most strains except for DB3.1). As a result, uncut or religated plasmid would produce little background. In our experience, this approach has a number of difficulties. Extraction of cut backbone from inserts required the use of gel purification, which is difficult with high concentrations of DNA, and problematic in yield and quality. The P1010 insert also showed remarkable ability to mutate (usually by frame shift) to a form not toxic to normal cells, leading to significant background. | ||
Our revised approach is to build construction plasmid using PCR techniques. Using primers which match the biobrick cloning sites in the reverse orientation, we produce PCR product containing the plasmid backbone with no insert and no uncut, circular plasmid. Errors are introduced in this PCR process, but the errors are of two forms: ones which result in plasmids which cannot be transformed, and those which produce viable, but mutated plasmid backbone. In either case, we don't care, since the insert sequence is what we care about. | Our revised approach is to build construction plasmid using PCR techniques. Using primers which match the biobrick cloning sites in the reverse orientation, we produce PCR product containing the plasmid backbone with no insert and no uncut, circular plasmid. Errors are introduced in this PCR process, but the errors are of two forms: ones which result in plasmids which cannot be transformed, and those which produce viable, but mutated plasmid backbone. In either case, we don't care, since the insert sequence is what we care about. | ||
| Line 9: | Line 9: | ||
* Template DNA for the backbone of choice (any plasmid with the correct backbone) at 10 ng/μl concentration. | * Template DNA for the backbone of choice (any plasmid with the correct backbone) at 10 ng/μl concentration. | ||
* Invitrogen PCR Supermix High Fidelity | * Invitrogen PCR Supermix High Fidelity | ||
* Primer Suffix-F, sequence ''actagtagcggccgctgcag'' at 30 pmol/μl | * Primer Suffix-F, sequence '''actagtagcggccgctgcag''' at 30 pmol/μl | ||
* Primer Prefix-R, sequence ''tctagaagcggccgcgaattc'' at 30 pmol/μl | * Primer Prefix-R, sequence '''tctagaagcggccgcgaattc''' at 30 pmol/μl | ||
Revision as of 19:31, 4 September 2006
Construction plasmid is pre-cut backbone plasmid DNA from the three different plasmid backbones used for three antibiotic assembly (pSB1AC3, pSB1AK3, and pSB1AT3). It is cut with EcoRI and PstI, and ready for use in three way ligation reactions. Ideally, it is free of inserts and uncut plasmid. There are several ways to make construction plasmids. Our original approach was to use plasmid containing the P1010 insert, coding for the ccdB protein generator. This protein product is toxic to cells not having the gyrA462 mutation (most strains except for DB3.1). As a result, uncut or religated plasmid would produce little background. In our experience, this approach has a number of difficulties. Extraction of cut backbone from inserts required the use of gel purification, which is difficult with high concentrations of DNA, and problematic in yield and quality. The P1010 insert also showed remarkable ability to mutate (usually by frame shift) to a form not toxic to normal cells, leading to significant background.
Our revised approach is to build construction plasmid using PCR techniques. Using primers which match the biobrick cloning sites in the reverse orientation, we produce PCR product containing the plasmid backbone with no insert and no uncut, circular plasmid. Errors are introduced in this PCR process, but the errors are of two forms: ones which result in plasmids which cannot be transformed, and those which produce viable, but mutated plasmid backbone. In either case, we don't care, since the insert sequence is what we care about.
The PCR product is cut with EcoRI and PstI, purified away from the short dsDNA fragments cut off, and used for assemblies. Since the quality of this construction plasmid is a key determiner in the success of three antibiotic cloning, substantial effort has been put into optimizing the reactions. This protocol describes the exact procedures and quality control techniques used to make the construction plasmid backbones.
Materials
- Template DNA for the backbone of choice (any plasmid with the correct backbone) at 10 ng/μl concentration.
- Invitrogen PCR Supermix High Fidelity
- Primer Suffix-F, sequence actagtagcggccgctgcag at 30 pmol/μl
- Primer Prefix-R, sequence tctagaagcggccgcgaattc at 30 pmol/μl
