Mazel/pSW7848

From OpenWetWare

< Mazel(Difference between revisions)
Jump to: navigation, search
Current revision (08:33, 26 September 2012) (view source)
 
Line 11: Line 11:
REFERENCE  1  (bases 1 to 3349)
REFERENCE  1  (bases 1 to 3349)
   AUTHORS  Marie-Eve VAL
   AUTHORS  Marie-Eve VAL
-
   JOURNAL  Notebook
+
   JOURNAL  PLoS Genet. 2012 Jan;8(1):e1002472. Epub 2012 Jan 12. PMID:22253612
 +
 
COMMENT    SECID/File created by Clone Manager, Scientific & Educational Software
COMMENT    SECID/File created by Clone Manager, Scientific & Educational Software
COMMENT    SECNOTES|Author:: Marie-Eve VAL
COMMENT    SECNOTES|Author:: Marie-Eve VAL

Current revision


Bacterial Genome Plasticity

Home     Research     Publications     Plasmids / Strains     Protocols     Lab Members     Contact     Internal     Links    



LOCUS pSW7848 3349 bp
DEFINITION Ligation of ccdB-araC-xbaI-sacI* into pSW23T* ACCESSION alternate name pMP7 KEYWORDS . SOURCE Unknown.

 ORGANISM  Unknown
           Unclassified.

REFERENCE 1 (bases 1 to 3349)

 AUTHORS   Marie-Eve VAL
 JOURNAL   PLoS Genet. 2012 Jan;8(1):e1002472. Epub 2012 Jan 12. PMID:22253612 

COMMENT SECID/File created by Clone Manager, Scientific & Educational Software COMMENT SECNOTES|Author:: Marie-Eve VAL

           Date:: 04 Feb 2009
           Notebook:: 
           Vector molecule:  pSW23T*
              Fragment ends: SacI and XbaI
              Fragment size: 1789
           Insert molecule:  ccdB-araC-xbaI-sacI*
              Fragment ends: XbaI and SacI
              Fragment size: 1560

FEATURES Location/Qualifiers

    misc_feature    46..302
                    /gene="oriT RP4"
                    /SECDrawAs="Region"
    misc_feature    329..359
                    /gene="MCS'"
                    /SECDrawAs="Region"
    CDS             complement (392..1321)
                    /gene="araC"
                    /SECDrawAs="Gene"
    CDS             1609..1914
                    /gene="ccdB"
                    /SECDrawAs="Gene"
    misc_feature    1979..2405
                    /gene="oriVR6K"
                    /SECDrawAs="Region"
    CDS             complement (2479..3138)
                    /gene="cat"
                    /SECDrawAs="Gene"

>pSW7848

CAATTGATATCGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTAC CAGCGCTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTT TTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAGGG TTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATA GGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTA TTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGG CGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGAT CCACTAGTTCTAGAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAA CTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGAAACTCGC TCGGGCTGGCCCCGGTGCATTTTTTAAATACTCGCGAGAAATAGAGTTGA TCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTAGT GCTCAAAAGCAGCTTCGCCTGACTAATGCGTTGGTCCTCGCGCCAGCTTA AGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGC GACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGC CAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCG GTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGC TCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCC GGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTT CATCCGGGCGAAAGAAACCCGTATTGGCAAATATTGACGGCCAGTTAAGC CATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCA TTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGA ACAGCAAAATATCACCCGGTCGGCAGACAAATTCTCGTCCCTGATTTTTC ACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCC CAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCG TTAAACCCGCCACCAGATGGGCGTTAAACGAGTATCCCGGCAGCAGGGGA TCATTTTGCGCTTCAGCCATACTTTTCATACTCCCACCATTCAGAGAAGA AACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACT GGCTCTTCTCGCTAACCCAACCGGTAACCCCGCTTATTAAAAGCATTCTG TAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTA TAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTT GCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGC TTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGATGGA GTGAAACGATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTAT CGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACG GATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCC GTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATG ACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGC TGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGT TCTGGGGAATATAAGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAAT TGCGCGCAATTCCCATGTCAGCCGTTAAGTGTTCCTGTGTCACTCAAAAT TGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGCGTTACATCCCTGGCTTGT TGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTT TTTTTCTTATAAAACTTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTA TATTAATTTTATTGTTCAAACATGAGAGCTTAGTACGTGAAACATGAGAG CTTAGTACGTTAGCCATGAGAGCTTAGTACGTTAGCCATGAGGGTTTAGT TCGTTAAACATGAGAGCTTAGTACGTTAAACATGAGAGCTTAGTACGTGA AACATGAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCTGATCTTCA GATCCTCTACGCCGGACGCATCGTGGCCGGATCAGATCTGATATCGTCGC AGACCAAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTT CTAGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCA TCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATC ACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGC CTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCC ATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGC TGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGT TTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGG AAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTC ATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCAC CGTCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCA AGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGT CTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATT GAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGAT ATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTT AGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTA TTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCAT TTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGG ATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGGCG

Personal tools