Mazel:Protocols
From OpenWetWare
The SOS response controls integron recombination
Émilie Guerin, Guillaume Cambray, Neus Sanchez-Alberola, Susana Campoy, Ivan Erill, Sandra Da Re, Bruno Gonzalez-Zorn, Jordi Barbé, Marie-Cécile Ploy, Didier Mazel.
Bacterial strains, plasmids and oligonucleotides
See Tables 1, 2 and 3, respectively (below).
Electrophoresis mobility shift assays (EMSA)
The V. cholerae N16961 lexA gene was amplified using primers (NdelexAVch and XholexAVch) and cloned into a pET15b vector. Over-expression and purification of the corresponding LexA protein was performed as described previously for other LexA proteins (1). Each V. cholerae DNA probe was constructed using two complementary 78 bp synthetic oligonucleotides (see Table 3) that were assembled together and cloned in the pGEMT vector (Roche). The pMUR050 EMSA fragments were obtained using INTG_up and INTG_dw primers and either pUA1105 and pUA1106 plasmids as a probe for Pint1 or Pint2(+CCC) amplification, respectively. EMSA probes were obtained by amplification using M13F/pUC and DIG-M13R/pUC oligonucleotides. EMSA experiments were performed as described before (1) using either 80 nM V. cholerae LexA or 200 nM E. coli LexA protein and 20 ng of each DIG-marked DNA probe in the binding mixture. All samples were loaded in 6% non-denaturing Tris-glycine polyacrylamide gel. Digoxigenin-labeled DNA-protein complexes were detected using the manufacturer’s protocol (Roche).
Construction of class 1 integron derivatives.
All experiments were performed in E. coli MG1655 derivatives. Expression reporters. Plasmid pPint1 was constructed by cloning a DNA fragment containing the attI site (PCR on pAT674 with primers pint1 and Fwd) into pSU38totlacZ at EcoRI/BamHI. pPint1lexAmut1 and pPint1lexAmut2 carrying mutations of the LexA box were obtained using PCR assembly (primers lexAmutL/fw, lexAmutR/pint1 and intI1LEcoRI/ORF11R) and cloned at EcoRI/BamHI in pSU38totlacZ. Plasmid pZE1-IntIw was constructed by cloning a DNA fragment containing the attI site and the intI1 gene (PCR on pRMH821 with primers IntI1LEcoRI and ORF11R) into pZE1-mcs1 at EcoRI/BamHI. pZE1-mcs1 is a promoter-less derivative of pZE12-mcs1 (2) (deletion of PLlacO-I by XhoI digestion). pZE1-IntIw-lexAmut2 carrying a mutation in the LexA box was obtained by PCR assembly using primers lexAmut2L/intILEcoRI, lexAmut2R/ORF11R and intI1LEcoRI/ORF11R and cloned at EcoRI/BamHI in pZE1-mcs1. PCR were done using the PhusionTM polymerase (Finnzymes) following the manufacturer instructions. E. coli strain MG1656 (MG1655 lac- (3)) was then transformed with these plasmids.
Constructions of V. cholerae superintegron derivatives.
The different constructions and mutations were introduced in the chromosomes of V. cholerae N16961 by homologous recombination of suicide plasmids, mainly pSW23T derivatives unless specified otherwise. All constructs were delivered from E. coli 2163 by conjugation following a protocol previously described (4). All PCR amplifications for gene cloning were carried out with the Herculase IITM polymerase (Stratagene).
Gene deletions and mutations.
Deletion of the lacZ (VC2338) and recA (VC0543) genes were obtained using pMEV69 and pMEV68 respectively (5). Both the intIA deletion and the A91D mutation in lexA were constructed using pSW23TccdB (plasmid 4230), a counter selectable version of pSW23T, allowing marker-less gene replacement in two steps (6). 500 bp of the DNA regions located upstream and downstream of the intIA gene were obtained by PCR on V. cholerae N16961 genomic DNA (primers 545+546 and 547+548). These were concatenated by assembly PCR on both sides of a FRT-arr2-FRT marker (primers 546+548) and cloned at the EcoRI site of pSW23TccdB to yield plasmid 6646. The lexA gene was amplified from V. cholerae N16961 genomic DNA (primers 551+552) and cloned at the EcoRI site of pSW23TccdB. The A91D mutation corresponding to the lexAind allele was introduced by site directed mutagenesis (primers 553+554) to give plasmid 6780. This allowed constructing strains N16961Δlac, N16961ΔlacΔintIA, N16961ΔlacΔintIAΔrecA and N16961ΔlacΔintIA lexAind, in successive experiments (strains 4851, 6703, 6989 and 6704 respectively).
Construction of the expression reporter strains.
A pSW23T-aph derivative (plasmid 4730) was constructed by cloning of the aph gene from pSU38 in KpnI upon amplification by PCR (primers 555+556). The E. coli lacZ gene was fused to the 500bp region upstream of the intIA initiation codon (UPintIA) by assembly PCR (primers 557+560 and 558+559 then 557+558) and cloned into pSW23T-aph at site EcoRI/SacII. The resulting pSW23T-aph:: UPintIA-lacZ (plasmid 6930) was subsequently altered by site directed mutagenesis to modify the LexA box controlling intIA expression. In pSW23T-aph:: UPintIA-lacZ_1415 (primers 14+15; plasmid 6383), the WT box CTGTACAAATAACCAG was mutated into TAATACAAATAACCAG to restore a consensual -10 promoter, while removing the key LexA recognition triplet CTG. In pSW23T-aph:: UPintIA-lacZ_2425 (oligo 24+25; plasmid 7510), both ends of the LexA box were mutated into CTCTACAAATAACGAG. The plasmids were integrated at the intIA locus through homologous recombination with the chromosomal UPintIA region. Plasmid pSW23T-aph:: UPintIA-lacZ was recombined into strains N16961ΔlacΔintIA , N16961ΔlacΔintIAΔrecA and N16961 Δlac ΔintI lexAind- to give strains 7450, 7392 and 7286 respectively. Allele integration in the N16961ΔlacΔintIAΔrecA strain, was accomplished through temporary RecA complementation using an exogenous recA gene carried on a thermosensitive plasmid (pJJC2791, (7)). pSW23T-aph:: UPintIA-lacZ _1415 and pSW23T-aph:: UPintIA-lacZ _2425 were integrated into N16961 ΔlacΔintIA (strains 7451 and 7553).
B-galactosidase assays
E. coli cells were cultured in Brain Heart Infusion (BHI) or in Mueller Hinton (MH) broth. V. cholerae cells were cultured in marine broth (DIFCO) with kanamycin (25 µg.mL-1). All cultures were grown at 37°C with shaking. For both species, overnight culture of reporter strains were diluted 1:100 and grown until OD600 = 0.3. The SOS response was then induced for 1 hour in half of the culture, by addition of antibiotics (mitomycin C, 1.6/0.2 ug.mL-1; ciprofloxacin, 25/200 ng.mL-1; trimethoprim, 2/2 ug.mL-1; ampicillin, 100/500 ug.mL-1; concentrations for E. coli / V. cholerae). B-galactosidase activities were measured as described by Miller (J. Miller, 1972). For E. coli trimethoprim inductions were performed in MH, and bacteria were grown for 4 hours after trimethoprim addition. All assays were performed at least 3 times.
Cassette excision assay.
Reporter construction. The deletion assay is derived from the one we previously used (8). This assay is based on the integron integrase ability to delete a synthetic cassette, catT4-attCVCR2, by mediating recombination between the attCaadA7 and attCVCR2 sites. We observed that several natural variants of the resistance gene aac6'-Ib were fused on their 5' side with other genes, leading to apparently functional hybrid proteins (e.g. accessions AJ584652 and AF453998). The synthetic cassette disrupts a selectable gene, here a derivative of aac6'-Ib, referred to as aac6’-Ib*, carried on a pSU38 (pSU38::aac6’-Ib*::attCaadA7-catT4-attCVCR2 i.e. plasmid 6851, accession FJ477110) and prevents the aac6’-Ib* productive translation by introducing a stop codon in the reading frame, 111 bp downstream of the ATG codon (MIC of tobramycin: 0.19 and 1.5 µg.mL-1, for E. coli and V. cholerae respectively). IntI mediated deletion of the catT4-attCVCR2cassette restores a single reading frame allowing functional aminoglycoside acetyltransferase 6’ synthesis that confers selectable resistance to tobramycin (MIC: 6 and 20 µg.mL-1, for E. coli and V. cholerae respectively). We took advantage of this feature and found that the aac(6')-Ib* derivative which contained a 5’ in-frame addition corresponding to the lacZα first codons fused to the attCaadA7 site previously used (8) was functional and provided an unambiguously selectable resistance phenotype.
E. coli excision assay.
MG1656/p6851 freshly electroporated with pZE1-intI1w or pZE1-intI1wlexAmut2 were grown in LB overnight. Serial dilutions of the culture were plated on LB + kanamycin and LB + tobramycin (5 µg.mL-1) to estimate Colony Forming Units (CFU). The excision rate was calculated as UFC.mL-1 on Tm / UFC.mL-1 on Km. Experiments were performed 3 times.
V. cholerae excision assay.
N16961Δlac cells were electroporated with plasmid 6851 and grown overnight on Marine + kanamycin plates. A marine + kanamycin liquid culture was inoculated from a transformed colony, and grown for 3 hours. Half of the culture was then induced with mitomycin C (20 ng.mL-1). Cultures were continued for 36 h at 37°C. Serial dilutions of the cultures were plated on Marine + kanamycin (25 µg.mL-1) and Marine + tobramycin (10 µg.mL-1) to estimate Colony Forming Units (CFU). The excision rate was estimated as described for E. coli.
Table 1 : List of bacterial strains used in this study
| Name | Relevant Genotype | Reference |
| 6703 | V. cholerae N16961 ΔlacZ ΔintIA | This work |
| 4851 | V. cholerae N16961 ΔlacZ | This work |
| 6989 | V. cholerae N16961 ΔlacZ ΔintIA ΔrecA | This work |
| 6704 | V. cholerae N16961 ΔlacZ ΔintIA lexAind- (A91D) | This work |
| 7450 | 4851 with intIA reporter insertion | This work |
| 7392 | 6989 with intIA reporter insertion | This work |
| 7286 | 6704 with intIA reporter insertion | This work |
| 7451 | 4851 with intIA reporter insertion and mutation in the LexA box | This work |
| 7553 | 4851 with intIA reporter insertion and mutation in the LexA box | This work |
| 197 | E. coli MG1656 (lacZ- derivative of E. coli MG1655) | (3) |
| 417 | E. coli MG1656 ΔrecA | This work |
| 430 | E. coli MG1656 ΔsulA ΔlexA | This work |
Table 2: List of plasmids used in this study
| name | description | reference |
| pMEV68 | Deletion of the V. cholerae lacZ (VC2338) | (5) |
| pMEV69 | Deletion of the V. cholerae recA (VC0543) | Val ME, unpublished |
| p4230 | counterselectable suicide plasmid | (6) |
| p6646 | Replacement of V.cholerae N16961 intIA by FRT-arr2-FRT marker | This work |
| p6780 | lexA A91D allele | This work |
| p4730 | pSW23T-aph [Cm Km] | This work |
| p6930 | 4730 with intIA::lacZ fusion | This work |
| p6383 | 6930 with mutation in lexA box | This work |
| p7510 | 6930 with mutation in lexA box | This work |
| pJJC2791 | thermosensitive plasmid expressing recA | (7) |
| p6851 | cassette excision reporter (pSU38::aac6'-Ib*::attCaadA7-catT4-attCVCR2) | This work |
| pAT674 | 6.5-kbs BamHI fragment from In40 class I integron cloned into pBGS18. | (9) |
| pRMH821 | R388 derivative with a weak Pc variant | (10) |
| pSU38ΔtotlacZ | Vector carrying lacZ coding sequence with no translation initiation region nor promoter. | Jové T, under submission |
| pPint1 | attI site from In40 class 1 integron cloned into pSU38DtotlacZ | This work |
| pPint1lexAmut1 | pPint1 carrying the mutation 1 of the LexA box | This work |
| pPint1lexAmut2 | pPint1 carrying the mutation 2 of the LexA box | This work |
| pZE1-mcs1 | promoterless derivative of pZE12-mcs1 | This work |
| pZE1-IntIw | attI site + IntI1 gene from In40 class I integron cloned into pZE1-mcs1 | This work |
| pZE1-IntIwlexAmut2 | pZE1-IntIw carrying the mutation 2 of the LexA box | This work |
Table 3: List of primers used in this study
| Name | Sequence (5' > 3') |
| 14 | TAAAAACAACCAACAAATATAATACAAATAACCAGTTAAATATTCAGTGAGAACT |
| 15 | AGTTCTCACTGAATATTTAACTGGTTATTTGTATTATATTTGTTGGTTGTTTTTA |
| 24 | TAAAAACAACCAACAAATACTCTACAAATAACGAGTTAAATATTCAGTGAGAACT |
| 25 | AGTTCTCACTGAATATTTAACTCGTTATTTGTAGAGTATTTGTTGGTTGTTTTTA |
| 549 | TTTTGAATTCTTCCATAGTTCTCCCAAATGG |
| 550 | GTGAAATCTCATGATTTCGCAGAGTTAGCTCACTCATTAGG |
| 551 | TTTGAATTCACATCACCACACACCAGTTGATAAC |
| 552 | TTTGAATTCTGGCATGTGTTTGCAACGTCAGCAAG |
| 553 | CGTTGCCGCGGGTGAACCGATTCTT |
| 554 | GTTCACCCGCGGCAACGCGGCCAAT |
| 555 | AAAGGTACCTAGAAAGCCAGTCCGCAGAAA |
| 556 | AAAGGTACCTGGGCGAAGAACTCCAGCATG |
| 557 | CAGGAATCCCTGTTCAATTATTGTGTTGAGTTCTT |
| 558 | AATAACCGCGGTTATTATTATTTTTGACACCAGACCAAC |
| 559 | GTTAAATATTCAGTGAGAACTATATGACCATGATTACGG |
| 560 | CCGTAATCATGGTCATATAGTTCTCACTGAATATTTAAC |
| lexAmut1L | CCGAGGCATAGATAATACAAAAAAACAGTCATAA |
| lexAmut1R | TGTTTTTTTGTATTATCTATGCCTCGGGCATCCA |
| lexAmut2L | TGTACAAAAAAACTTCATAACAAGCCATG |
| lexAmut2R | GGCTTGTTATGAAGTTTTTTTGTACAGTCTATG |
| IntI1LEcoRI | CCGGAATTCTGCCTACCTCTCACTAGTG |
| ORF11R | GCGGGATCCAGGTAACTTTGTTTTAGGGCGACTGCCCT |
| Fw | CGCCAGGGTTTTCCCAGTCAC |
| pint1 | CCGGAATTCCTTTGTTTTAGGGCGACTG |
| pint2 | GCGGGATCCATGGCTTGTTATGACTGTT |
| P1_sulA | TTAATGATACAAATTAGAGTGAATTTTTAGCCCGGAAAGTTGTCTCGTGGCGTGAGAGGAGTGTAGGCTGGAGCTGCTTC |
| P2_sulA | ATGTACACTTCAGGCTATGCACATCGTTCTTCGTCGTTCTCATCCGCAGCAAGTAAAATTATGGGAATTAGCCATGGTCC |
| P1_lexA | ATGAAAGCGTTAACGGCCAGGCAACAAGAGGTGTTTGATCTCATCCGTGATCACATCAGCGTGTAGGCTGGAGCTGCTTC |
| P2_lexA | TTACAGCCAGTCGCCGTTGCGAATAACCCCAACCGCCAGCCCTTCAATGGTGAAGCTCTGATGGGAATTAGCCATGGTCC |
| NdelexAVch | CATATGAAGCCGTTAACCCCTCGCC |
| XholexAVch | CTCGAGTCACATCCAAGTGCTGTTG |
| NdelexAEco | CATATGAAAGCGTTAACGGCCAGGC |
| XholexAEco | CTCGAGTTACAGCCAGTCGCCGTTGC |
| wtplexVchF | ATCTTGACATAAAAACAACCAACAAATACTGTACAAATACTGTACAAATAACCAGTTAAATATTCAGTGAGAACTATA |
| wtplexVchR | ATATAGTTCTCACTGAATATTTAACTGGTTATTTGTACAGTATTTGTACAGTATTTGTTGGTTGTTTTTATGTCAAGA |
| #1plexVchF | ATCTTGACATAAAAACAACCAACAAATACTGTACAAATACTCTACAAATAACCAGTTAAATATTCAGTGAGAACTATA |
| #1plexVchR | ATATAGTTCTCACTGAATATTTAACTGGTTATTTGTAGAGTATTTGTACAGTATTTGTTGGTTGTTTTTATGTCAAGA |
| #2plexVchF | ATCTTGACATAAAAACAACCAACAAATACTGTACAAATACTGTACAAATAACGAGTTAAATATTCAGTGAGAACTATA |
| #2plexVchR | ATATAGTTCTCACTGAATATTTAACTCGTTATTTGTACAGTATTTGTACAGTATTTGTTGGTTGTTTTTATGTCAAGA |
| #3plexVchF | ATCTTGACATAAAAACAACCAACAAATACTGTACAAATACTCTACAAATAACGAGTTAAATATTCAGTGAGAACTATA |
| #3plexVchR | ATATAGTTCTCACTGAATATTTAACTCGTTATTTGTAGAGTATTTGTACAGTATTTGTTGGTTGTTTTTATGTCAAGA |
| #4plexVchF | ATCTTGACATAAAAACAACCAACAAATACTGTACAAATATAATACAAATAACCAGTTAAATATTCAGTGAGAACTATA |
| #4plexVchR | ATATAGTTCTCACTGAATATTTAACTGGTTATTTGTATTATATTTGTACAGTATTTGTTGGTTGTTTTTATGTCAAGA |
| #5plexVchF | ATCTTGACATAAAAACAACCAACAAATACTGTACAAATACTGTACAAATAACACTTTAAATATTCAGTGAGAACTATA |
| #5plexVchR | ATATAGTTCTCACTGAATATTTAAAGTGTTATTTGTACAGTATTTGTACAGTATTTGTTGGTTGTTTTTATGTCAAGA |
| #6plexVchF | ATCTTGACATAAAAACAACCAACAAATACTGTACAAATATAATACAAATAACACTTTAAATATTCAGTGAGAACTATA |
| #6plexVchR | ATATAGTTCTCACTGAATATTTAAAGTGTTATTTGTATTATATTTGTACAGTATTTGTTGGTTGTTTTTATGTCAAGA |
| INTG_up | CCCGCACGATGATCGTGCCG |
| INTG_dw | CAGCGACATCCTTCGGCGCG |
(3, 5-7, 9, 10)
References
1. M. Abella et al., Mol Microbiol 54, 212 (Oct, 2004).
2. R. Lutz, H. Bujard, Nucleic Acids Res 25, 1203 (Mar 15, 1997).
3. O. Espeli, L. Moulin, F. Boccard, J Mol Biol 314, 375 (Nov 30, 2001).
4. G. Demarre et al., Research in Microbiology 156, 245 (2005).
5. M. E. Val et al., PLoS Genet 4, e1000201 (2008).
6. F. Le Roux, J. Binesse, D. Saulnier, D. Mazel, Appl Environ Microbiol 73, 777 (Feb, 2007).
7. J. E. Cronan, J Bacteriol 185, 6522 (Nov, 2003).
8. G. Demarre, C. Frumerie, D. N. Gopaul, D. Mazel, Nucleic Acids Res 35, 6475 (2007).
9. M. C. Ploy, P. Courvalin, T. Lambert, Antimicrob Agents Chemother 42, 2557 (Oct, 1998).
10. C. M. Collis, G. D. Recchia, M. J. Kim, H. W. Stokes, R. M. Hall, J Bacteriol 183, 2535 (Apr, 2001).


