Mesoplasma florum: Tn5 Transposase: Difference between revisions
(21 intermediate revisions by 2 users not shown) | |||
Line 1: | Line 1: | ||
{{back to protocols}} | |||
==Tn5 Transposase production== | ==Tn5 Transposase production== | ||
Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre | Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre. Here, we make it from a plasmid provided by Prof. Wolfgang Hillen PMID 16820464. The protocol also builds on the NEB IMPACT-CN protein purification kit. | ||
===Materials=== | ===Materials=== | ||
Line 18: | Line 19: | ||
** 50 mM Tris-HCl pH 7.5 | ** 50 mM Tris-HCl pH 7.5 | ||
** 100 mM NaCl | ** 100 mM NaCl | ||
** 0.1 mM EDTA | ** 0.1 mM EDTA -- our version has 5 mM EDTA, since we never want in-vitro action | ||
** 1 mM DTT | ** 1 mM DTT | ||
===Protocol=== | ===Protocol=== | ||
* Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture. | * Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture overnight | ||
* Inoculate | ** Grow in 35 ug/ml chloramphenicol and 100 ug/ml carbenicillin | ||
* Induce cultures at OD 0.5 with | * Centrifuge and remove the supernatent to eliminate beta-lactamase from the medium. | ||
* | * Inoculate 1 liter of LB/Cm/Amp culture medium with the culture and grow for 5-6 hours at 25 C until OD 0.5 | ||
* Spin down a second time and resuspend in | * Induce cultures at OD 0.5 with 500 uM IPTG and grow an additional 3-5 hours | ||
* Split and spin down cultures and resuspend in 80 ml cold water transferring to 50 ml centrifuge tubes | |||
* Spin down a second time and resuspend in 2 x 5 ml cold TEGX + Roche Complete protease inhibitor | |||
* Sonicate 3x pausing 10 minutes between sonications with the cells on ice | * Sonicate 3x pausing 10 minutes between sonications with the cells on ice | ||
* Centrifuge to remove cell debris | * Centrifuge at 4C to remove cell debris - 1 hour at 16,000 x g | ||
* Load a 2 cm diameter column with 20 ml chitin bead suspension (10 ml beads) | * Load a 2 cm diameter column with 20 ml chitin bead suspension (10 ml beads) | ||
* Wash the column with 100 ml TEGX buffer | * Wash the column with 100 ml cold TEGX buffer | ||
* Load the cell supernatent onto the column and allow it to flow through | * Load the cell supernatent onto the column and allow it to flow through | ||
* Flow the supernatent past the column a second time | * Flow the supernatent past the column a second time | ||
* Wash the column with 200 ml TEGX buffer | * Wash the column with 200 ml TEGX buffer | ||
* Add 1 ml of 1M | * Add 1 ml of 1M DTT to 20 ml of TEGX buffer | ||
* Flow the | * Flow the 21 ml DTT + TEGX into the column | ||
* Cap the column and hold at 4°C overnight | * Cap the column and hold at 4°C overnight | ||
* Recover the protein with 10 ml TEGX buffer flowed through the column | * Recover the protein with 10 ml TEGX buffer flowed through the column | ||
* Recover a second 10 ml similarly | |||
* Concentrate the protein by spinning in Centricon YM10 | * Concentrate the protein by spinning in Centricon YM10 | ||
* Dilute concentrate with 40% glycerol to bring final to 50% | * Dilute concentrate with 40% glycerol to bring final to 50% | ||
Line 49: | Line 53: | ||
* 1 pmol transposon = 2700 * 660 * 1e-12 = 1.8 ug | * 1 pmol transposon = 2700 * 660 * 1e-12 = 1.8 ug | ||
* 100 fmol transposon = 180 ng | * 100 fmol transposon = 180 ng | ||
===DNA binding tests=== | ===DNA binding tests=== | ||
Line 59: | Line 62: | ||
* DNA mixture 10*200 ng = 2 ug DNA = 2 ul DNA into 200 ul TEGX | * DNA mixture 10*200 ng = 2 ug DNA = 2 ul DNA into 200 ul TEGX | ||
* Tests 3/24 | |||
** 2 ul 116 ng/ul ME0 PCR DNA | |||
** 500 ng, 250, 125, 62.5, 31 ng Tpase in 20 ul final volume of storage buffer | |||
** incubate 1 hour 37C | |||
** overnight at 4C | |||
===Gel images, Goryshin00=== | ===Gel images, Goryshin00=== | ||
Line 73: | Line 82: | ||
** results: near linear increase of cut out fragments with transposase molar excess of 0-9x | ** results: near linear increase of cut out fragments with transposase molar excess of 0-9x | ||
===Standard Epicentre reaction=== | |||
* 1 ul DNA (100 ng/ul) in TE | |||
* 2 ul transposase | |||
* 1 ul glycerol | |||
*This is: | |||
** about 100 fmol or less transposon DNA | |||
** at 100 ng/ul, this is 3.8 pmol transposase or 38x molar excess | |||
** 25 ng/ul final, so expect 1e4 or so transformants | |||
===To Do=== | ===To Do=== | ||
* Prep new Tn5 protein | * Prep new Tn5 protein (on hold, unnecessary) | ||
* quantitate existing stock with BSA dilution and gel | * quantitate existing stock with BSA dilution and gel (done, spec readings approximately correct) | ||
* Make storage buffer, dilute existing stock into storage buffer | * Make storage buffer, dilute existing stock into storage buffer (done) | ||
* run Goryshin00 style test of transposome formation | * run Goryshin00 style test of transposome formation (to do; initial gel unconvincing) | ||
* Run Goryshin98 style test of transposon cutting | * Run Goryshin98 style test of transposon cutting (to do) | ||
* Try transforming E. coli cells (done, this is what counts, compared to Epicentre enzyme is OK) | |||
===pWH1891 Sequence information=== | |||
* T7 and Intein-R primers, ATG start at 45 | |||
* Truncates aa's 1-4 from canonical sequence | |||
* Mutations | |||
** E54K -- improve binding to OE | |||
** M56A -- eliminate start for C-terminal inhibitory protein | |||
** L372P -- hyperactive mutation | |||
<code> | |||
>pWH1891<br> | |||
CCCTCTAGAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGATAACTTCTGCTCTTCATCGTGCGGCCGACTGGGCTAAATCTGTGTTCTCTTC | |||
GGCGGCGCTGGGTGATCCTCGCCGTACTGCCCGCTTGGTTAACGTCGCCGCCCAATTGGCAAAATATTCTGGTAAATCAATAACCATCTCATCAGAGGGT | |||
AGTAAAGCCGCCCAGGAAGGCGCTTACCGATTTATCCGCAATCCCAACGTTTCTGCCGAGGCGATCAGAAAGGCTGGCGCCATGCAAACAGTCAAGTTGG | |||
CTCAGGAGTTTCCCGAACTGCTGGCCATTGAGGACACCACCTCTTTGAGTTATCGCCACCAGGTCGCCGAAGAGCTTGGCAAGCTGGGCTCTATTCAGGA | |||
TAAATCCCGCGGATGGTGGGTTCACTCCGTTCTCTTGCTCGAGGCCACCACATTCCGCACCGTAGGATTACTGCATCAGGAGTGGTGGATGCGCCCGGAT | |||
GACCCTGCCGATGCGGATGAAAAGGAGAGTGGCAAATGGCTGGCAGCGGCCGCAACTAGCCGGTTACGCATGGGCAGCATGATGAGCAACGTGATTGCGG | |||
TCTGTGACCGCGAAGCCGATATTCATGCTTATCTGCAGGACAAACTGGCGCATAACGAGCGCTTCGTGGTGCGCTCCAAGCACCCACGCAAGGACGTAGA | |||
GTCTGGGTTGTATCTGTACGACCATCTGAAGAACCAACCGGAGTTGGGTGGCTATCAGATCAGCATTCCGCAAAAGGGCGTGGTGGATAAACGCGGTAAA | |||
CGTAAAAATCGACCAGCCCGCAAGGCGAGCTTGAGCCTGCGCAGTGGGCGCATCACGCTAAAACAGGGGAATATCACGCTCAACGCGGTGCTGGCCGAGG | |||
AGATTAACCCGCCCAAGGGTGAGACCCCGTTGAAATGGTTGTTGCTGACCAGCGAACCGGTCGAGTCGCTAGCCCAAGCCTTGCGCGTCATCGACATTTA | |||
TACCCATCGCTGGCGGATCGAGGAGTTCCATAAGGCATGGAAAACCGGAGCAGGAGCCGAGAGGCAACGCATGGAGGAGCCGGATAATCTGGAGCGGATG | |||
GTCTCGATCCTCTCGTTTGTTGCGGTCAGGCTGTTACAGCTCAGAGAAAGCTTCACGCCGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGG | |||
AACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGC | |||
AGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGGAAGGT | |||
TGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCGGGTGCTTTGCCAAGGGTACCAATGTTT<br> | |||
TAATGGCGGATGGGTCTATGA | |||
</code> | |||
===Testing the transposase=== | |||
* Transform 50 μl of E. coli Top10 electrocompetent cells with: | |||
** Tn5 transposons (1 μl); plate out on Tet plates, count colonies | |||
** pUC19 positive control 10 pg/μl; plate out on amp plates | |||
** Electroporation at 2.5 KV in 2 mm gap cuvette | |||
** pUC19 colonies visible in six hours under the microscope | |||
** Tet resistant colonies are not visible at that time | |||
===Notes=== | |||
* Davies00 uses 100 mM hydroxylamine as a cleavage reagent instead of DTT | |||
===References=== | ===References=== | ||
* [http://www.neb.com/nebecomm/products/productE6900.asp NEB IMPACT-CN web page] | * [http://www.neb.com/nebecomm/products/productE6900.asp NEB IMPACT-CN web page] | ||
* [http://www.dwalab.ca/labman/index.html Andrews Lab web site] | |||
* Goryshin00 | * Goryshin00 | ||
* Goryshin98 | * Goryshin98 | ||
* Kostner06 | * Kostner06 | ||
* [http://epibio.com/item.asp?ID=292 Epicenter EZ-TN transposase] | * [http://epibio.com/item.asp?ID=292 Epicenter EZ-TN transposase] | ||
* Hank Daum at Epicentre, hank.daum@epibio.com | |||
[[category:Mesoplasma florum]][[category:protocol]] |
Latest revision as of 23:02, 11 October 2011
back to protocols | ||
Tn5 Transposase production
Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre. Here, we make it from a plasmid provided by Prof. Wolfgang Hillen PMID 16820464. The protocol also builds on the NEB IMPACT-CN protein purification kit.
Materials
- pWH1891 plasmid (kind gift of Prof. Wolfgang Hillen)
- BL21(DE3)pLysS cells
- TEGX buffer
- 10 mM Tris-HCl pH 7.5
- 700 mM NaCl
- 1 mM EDTA
- 10% glycerol
- 0.1% Triton X-100
- Storage buffer (Epicentre)
- 50% glycerol
- 50 mM Tris-HCl pH 7.5
- 100 mM NaCl
- 0.1 mM EDTA -- our version has 5 mM EDTA, since we never want in-vitro action
- 1 mM DTT
Protocol
- Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture overnight
- Grow in 35 ug/ml chloramphenicol and 100 ug/ml carbenicillin
- Centrifuge and remove the supernatent to eliminate beta-lactamase from the medium.
- Inoculate 1 liter of LB/Cm/Amp culture medium with the culture and grow for 5-6 hours at 25 C until OD 0.5
- Induce cultures at OD 0.5 with 500 uM IPTG and grow an additional 3-5 hours
- Split and spin down cultures and resuspend in 80 ml cold water transferring to 50 ml centrifuge tubes
- Spin down a second time and resuspend in 2 x 5 ml cold TEGX + Roche Complete protease inhibitor
- Sonicate 3x pausing 10 minutes between sonications with the cells on ice
- Centrifuge at 4C to remove cell debris - 1 hour at 16,000 x g
- Load a 2 cm diameter column with 20 ml chitin bead suspension (10 ml beads)
- Wash the column with 100 ml cold TEGX buffer
- Load the cell supernatent onto the column and allow it to flow through
- Flow the supernatent past the column a second time
- Wash the column with 200 ml TEGX buffer
- Add 1 ml of 1M DTT to 20 ml of TEGX buffer
- Flow the 21 ml DTT + TEGX into the column
- Cap the column and hold at 4°C overnight
- Recover the protein with 10 ml TEGX buffer flowed through the column
- Recover a second 10 ml similarly
- Concentrate the protein by spinning in Centricon YM10
- Dilute concentrate with 40% glycerol to bring final to 50%
- Store aliquots at -80 and -20
- Dilute to final 100 ng/ul (1.8 pmol/ul) with storage buffer for use
Molarity
- Gel runs at 55 KD, approximately correct for a 450 AA protein.
- Kostner06 uses 100-500 fmol DNA + 5x excess protein, or .5 - 2.5 pmol
- 1 pmol protein = 55000 g/mol * 1e-12 mol = 55 ng
- 1 pmol transposon = 2700 * 660 * 1e-12 = 1.8 ug
- 100 fmol transposon = 180 ng
DNA binding tests
- Use constant 200 ng of DNA (dilute from 1 ug/ul stock)
- Use serial dilutions of protein starting at 8 ug/ul
- 2x dilutions 0, 2, 1, 500, 250, 125, 62.5, 31.25, 15.6, 0 into 20ul TEGX + 200 ng/ul transposon DNA
- Incubate 30 minutes at 37
- Run on 0.8% E-Gel
- DNA mixture 10*200 ng = 2 ug DNA = 2 ul DNA into 200 ul TEGX
- Tests 3/24
- 2 ul 116 ng/ul ME0 PCR DNA
- 500 ng, 250, 125, 62.5, 31 ng Tpase in 20 ul final volume of storage buffer
- incubate 1 hour 37C
- overnight at 4C
Gel images, Goryshin00
- Fig 1, 1.8 Kb transposon reacted at 2.5 ng/ul (total 1 ug) with Tn5 transposase at 10 ng/ul (total 4 ug) in 400 ul final volume, 1 hour at 37C
- this is about 1 pmol of DNA and 72 pmol transposase, or a 72x molar excess of transposase
- Concentrated to 20 ul and run on a 1.2% gel
- 3.7 Kb transposon reacted at 50 ng/ul (2 ug total) with Tn5 transposase at 10 ng/ul (400 ng total) in 40 ul volume, 1 hour at 37C
- this is 1 pmol DNA and 7.2 pmol transposase, for a 3x molar excess
Goryshin98 DNA binding and cutting tests
- 0 to 3.8 pmol (nominal 2 ul of transposase, or 200 ng) of Tn5 transposase added to 0.26 pmol (nominal 1 ug of 5700 bp plasmid) plasmid in 20 ul volume
- done with a buffer of 100 mM potassium glutamate, 25 mM Tris-acetate pH 7.5, 10 mM Mg-acetate, 50 ug/ml BSA, 0.5 mM b-mercaptoethanol, 2 mM spermidine, 10 ug/ml tRNA
- incubated 1 hour at 20C, diluted 2-3x and incubated a further 4 hours at 37C (nominally to dilute CHAPS in transposase storage buffer)
- results: near linear increase of cut out fragments with transposase molar excess of 0-9x
Standard Epicentre reaction
- 1 ul DNA (100 ng/ul) in TE
- 2 ul transposase
- 1 ul glycerol
- This is:
- about 100 fmol or less transposon DNA
- at 100 ng/ul, this is 3.8 pmol transposase or 38x molar excess
- 25 ng/ul final, so expect 1e4 or so transformants
To Do
- Prep new Tn5 protein (on hold, unnecessary)
- quantitate existing stock with BSA dilution and gel (done, spec readings approximately correct)
- Make storage buffer, dilute existing stock into storage buffer (done)
- run Goryshin00 style test of transposome formation (to do; initial gel unconvincing)
- Run Goryshin98 style test of transposon cutting (to do)
- Try transforming E. coli cells (done, this is what counts, compared to Epicentre enzyme is OK)
pWH1891 Sequence information
- T7 and Intein-R primers, ATG start at 45
- Truncates aa's 1-4 from canonical sequence
- Mutations
- E54K -- improve binding to OE
- M56A -- eliminate start for C-terminal inhibitory protein
- L372P -- hyperactive mutation
>pWH1891
CCCTCTAGAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGATAACTTCTGCTCTTCATCGTGCGGCCGACTGGGCTAAATCTGTGTTCTCTTC
GGCGGCGCTGGGTGATCCTCGCCGTACTGCCCGCTTGGTTAACGTCGCCGCCCAATTGGCAAAATATTCTGGTAAATCAATAACCATCTCATCAGAGGGT
AGTAAAGCCGCCCAGGAAGGCGCTTACCGATTTATCCGCAATCCCAACGTTTCTGCCGAGGCGATCAGAAAGGCTGGCGCCATGCAAACAGTCAAGTTGG
CTCAGGAGTTTCCCGAACTGCTGGCCATTGAGGACACCACCTCTTTGAGTTATCGCCACCAGGTCGCCGAAGAGCTTGGCAAGCTGGGCTCTATTCAGGA
TAAATCCCGCGGATGGTGGGTTCACTCCGTTCTCTTGCTCGAGGCCACCACATTCCGCACCGTAGGATTACTGCATCAGGAGTGGTGGATGCGCCCGGAT
GACCCTGCCGATGCGGATGAAAAGGAGAGTGGCAAATGGCTGGCAGCGGCCGCAACTAGCCGGTTACGCATGGGCAGCATGATGAGCAACGTGATTGCGG
TCTGTGACCGCGAAGCCGATATTCATGCTTATCTGCAGGACAAACTGGCGCATAACGAGCGCTTCGTGGTGCGCTCCAAGCACCCACGCAAGGACGTAGA
GTCTGGGTTGTATCTGTACGACCATCTGAAGAACCAACCGGAGTTGGGTGGCTATCAGATCAGCATTCCGCAAAAGGGCGTGGTGGATAAACGCGGTAAA
CGTAAAAATCGACCAGCCCGCAAGGCGAGCTTGAGCCTGCGCAGTGGGCGCATCACGCTAAAACAGGGGAATATCACGCTCAACGCGGTGCTGGCCGAGG
AGATTAACCCGCCCAAGGGTGAGACCCCGTTGAAATGGTTGTTGCTGACCAGCGAACCGGTCGAGTCGCTAGCCCAAGCCTTGCGCGTCATCGACATTTA
TACCCATCGCTGGCGGATCGAGGAGTTCCATAAGGCATGGAAAACCGGAGCAGGAGCCGAGAGGCAACGCATGGAGGAGCCGGATAATCTGGAGCGGATG
GTCTCGATCCTCTCGTTTGTTGCGGTCAGGCTGTTACAGCTCAGAGAAAGCTTCACGCCGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGG
AACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGC
AGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGGAAGGT
TGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCGGGTGCTTTGCCAAGGGTACCAATGTTT
TAATGGCGGATGGGTCTATGA
Testing the transposase
- Transform 50 μl of E. coli Top10 electrocompetent cells with:
- Tn5 transposons (1 μl); plate out on Tet plates, count colonies
- pUC19 positive control 10 pg/μl; plate out on amp plates
- Electroporation at 2.5 KV in 2 mm gap cuvette
- pUC19 colonies visible in six hours under the microscope
- Tet resistant colonies are not visible at that time
Notes
- Davies00 uses 100 mM hydroxylamine as a cleavage reagent instead of DTT
References
- NEB IMPACT-CN web page
- Andrews Lab web site
- Goryshin00
- Goryshin98
- Kostner06
- Epicenter EZ-TN transposase
- Hank Daum at Epicentre, hank.daum@epibio.com