MurrayRM:PURExpress system notes and experience

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Worked example: inducible expression)
(DNA construction)
Line 19: Line 19:
==== PG1 ====
==== PG1 ====
This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).
This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).
==== LG2 ====
This is linear DNA extracted from BBa_I2035 using a simple forward and reverse primer.  The sequence for the relevant section of BBa_I2035, starting from the beginning of the promoter is
* Forward primer: tcatacgactcactataggggaat
* Reverse primer: aaacgggtcttgaggggttttttg
==== PG3 ====
(T7:RBS:lacI) - linear GFP on a LacI-repressible promoter with lacI on a constitutive T7 promoter on a plasmid (not fluoresce)
==== LR4 ====
(T7-Plac:RBS:RFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from plasmid provided by Karsten Temme at UCSF. This can be used as a replacement for LG2, if needed.
==== LG5 ====
(T7-RBS:lacI) - linear DNA with with LacI on a constitutive T7 promoter, constructed from BBa_2043. This can be used as a replacement for PG3, if needed.

Revision as of 13:07, 12 February 2010

Notes on using the NEB PURExpress system.


Worked example: inducible expression

To illustrate how the system works, this section describes an experiment to test out four different constructs:

  • PG1 (BBa_I2035) - GFP with a LacI-repressible promoter on a plasmid (fluoresce)
  • LG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035 (fluoresce)
  • LG2 + PG3 (T7:RBS:lacI) - linear GFP on a LacI-repressible promoter with lacI on a constitutive T7 promoter on a plasmid (not fluoresce)
  • LG2 + PG3 + 100 uM IPTG - GFP on a LacI-repressible promoter with lacI and IPTG present (fluoresce)

In addition, an RFP-based construct was developed, just in case I couldn't get access to BBa_I2035 and a constitutive T7-based lacI using a biobrick part:

  • LR4 (T7-Plac:RBS:RFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from plasmid provided by Karsten Temme at UCSF. This can be used as a replacement for LG2, if needed.
  • LG5 (T7-RBS:lacI) - linear DNA with with LacI on a constitutive T7 promoter, constructed from BBa_2043. This can be used as a replacement for PG3, if needed.

DNA construction

Only the BBa_I2035 plasmid is in the form needed for use with the PURE system. The other sequences were constructed using PCR-based editing.


This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).


This is linear DNA extracted from BBa_I2035 using a simple forward and reverse primer. The sequence for the relevant section of BBa_I2035, starting from the beginning of the promoter is

  • Forward primer: tcatacgactcactataggggaat
  • Reverse primer: aaacgggtcttgaggggttttttg


(T7:RBS:lacI) - linear GFP on a LacI-repressible promoter with lacI on a constitutive T7 promoter on a plasmid (not fluoresce)


(T7-Plac:RBS:RFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from plasmid provided by Karsten Temme at UCSF. This can be used as a replacement for LG2, if needed.


(T7-RBS:lacI) - linear DNA with with LacI on a constitutive T7 promoter, constructed from BBa_2043. This can be used as a replacement for PG3, if needed.

Personal tools