MurrayRM:PURExpress system notes and experience

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(PG3)
(Worked example: inducible expression)
Line 4: Line 4:
To illustrate how the system works, this section describes an experiment to test out four different constructs:
To illustrate how the system works, this section describes an experiment to test out four different constructs:
-
* PG1 (BBa_I2035) - GFP with a LacI-repressible promoter on a plasmid (fluoresce)
+
* PLG1 (BBa_I2035) - GFP with a LacI-repressible promoter on a plasmid (fluoresce)
-
* LG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035  (fluoresce)
+
* LLG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035  (fluoresce)
-
* LG2 + PG3 (T7:RBS:lacI) - linear GFP on a LacI-repressible promoter with lacI on a constitutive T7 promoter on a plasmid (not fluoresce)
+
* LLG2 + LCL3 (T7:RBS:lacI) - linear GFP on a LacI-repressible promoter with linear lacI on a constitutive T7 promoter (no fluorescense)
-
* LG2 + PG3 + 100  uM IPTG - GFP on a LacI-repressible promoter with lacI and IPTG present  (fluoresce)
+
* LLG2 + LCL3 + 100  uM IPTG - GFP on a LacI-repressible promoter with lacI and IPTG present  (fluoresce)
In addition, an RFP-based construct was developed, just in case I couldn't get access to BBa_I2035 and a constitutive T7-based lacI using a biobrick part:
In addition, an RFP-based construct was developed, just in case I couldn't get access to BBa_I2035 and a constitutive T7-based lacI using a biobrick part:
-
* LR4 (T7-Plac:RBS:RFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from plasmid provided by Karsten Temme at UCSF.  This can be used as a replacement for LG2, if needed.
+
* PLR4 (T7-Plac:RBS:RFP) - plasmid DNA with RFP on a LacI-repressible promoter, PCR'd from plasmid provided by Karsten Temme at UCSF and inserted into Novagen pET vector.  This can be used as a replacement for LLG2, if needed.
-
* LG5 (T7-RBS:lacI) - linear DNA with with LacI on a constitutive T7 promoter, constructed from BBa_2043.  This can be used as a replacement for PG3, if needed.
+
* LCL5 (T7-RBS:lacI) - linear DNA with with LacI on a constitutive T7 promoter, constructed from BBa_2043.  This can be used as a replacement for LCL3, if needed.
 +
 
 +
Naming scheme:
 +
  * L/P - DNA type: linear DNA versus plasmid
 +
  * C/L - promoter type: constitutive T7 promoter versus LacI-repressible
 +
  * G/L/R - coding region: GFP, RFP or LacI
=== DNA construction ===
=== DNA construction ===
Line 17: Line 22:
<blockquote>
<blockquote>
-
==== PG1 ====
+
==== PLG1 ====
This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).
This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).
-
==== LG2 ====
+
==== LLG2 ====
-
This is linear DNA extracted from BBa_I2035 using a simple forward and reverse primer.  The sequence for the relevant section of BBa_I2035, starting from the beginning of the promoter is
+
This is linear DNA containing a lacI-repressible T7 promoter, extracted from BBa_I2035 using a simple forward and reverse primer.  Use of this piece of DNA allows testing of linear DNA versus plasmid DNA.
 +
 
 +
The sequence for the relevant section of BBa_I2035, starting from the beginning of the promoter is
  tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactagatgcgtaaaggagaagaact
  tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactagatgcgtaaaggagaagaact
  tttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga
  tttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga
Line 34: Line 41:
* Reverse primer: aaacgggtcttgaggggttttttg
* Reverse primer: aaacgggtcttgaggggttttttg
-
==== PG3 ====
+
==== LCL3 ====
-
This plasmid consists of lacI on a constitutive T7-promoter.  It is constructed by inserting lacI into the PURE control plasmid (in place of DHFR). To do this, we need to make a copy of lacI, put restriction sites and then insert this into the control plasmid.
+
This sequence consists of lacI on a constitutive T7-promoter.  It is constructed by doing PCR amplification of lacI out of  a BBa_I2043 plasmid and then attaching the T7 promoter and RBS using the PURExpress universal primer.
 +
Sequence for lacI (from BBa_K091121 - wild type lacI):
 +
 
 +
>BBa_K091121 Part-only sequence (1083 bp)
 +
atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaa
 +
cgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgc
 +
cacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaa
 +
cgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgcca
 +
ttgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtac
 +
gcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggc
 +
tggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctga
 +
atgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcgga
 +
tatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagc
 +
gtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaata
 +
cgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtga
 +
 
 +
* Round 1 forward primer:
 +
* Round 1 reverse primer:
 +
* Round 2 forward primer: PURExpress universal forward primer
 +
* Round 2 reverse primer: same as round 1 reverse primer
 +
 
 +
==== PLR4 ====
 +
This is a linear sequence of DNA that can be used as a replacement for LLG2, in case I can't get BBa_I2035. In order to get this sequence, I have to insert RFP into a pET vector (has a lacI-repressible T7 promoter) and grow up some cells.
-
==== LR4 ====
+
==== LCL5 ====
-
(T7-Plac:RBS:RFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from plasmid provided by Karsten Temme at UCSF. This can be used as a replacement for LG2, if needed.
+
This is a substitute for LCL3 using the Novagen pLacI plasmid (in case I can't get BBa_I2043).  The primers are identical to LCL3 since we are just grabbing a standard lacI gene.  (Note: need to check there are no modifications to the sequences on the pLacI plasmid; if so, look for another source).
-
==== LG5 ====
 
-
(T7-RBS:lacI) - linear DNA with with LacI on a constitutive T7 promoter, constructed from BBa_2043. This can be used as a replacement for PG3, if needed.
 
</blockquote>
</blockquote>

Revision as of 14:51, 12 February 2010

Notes on using the NEB PURExpress system.

Contents

Worked example: inducible expression

To illustrate how the system works, this section describes an experiment to test out four different constructs:

  • PLG1 (BBa_I2035) - GFP with a LacI-repressible promoter on a plasmid (fluoresce)
  • LLG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035 (fluoresce)
  • LLG2 + LCL3 (T7:RBS:lacI) - linear GFP on a LacI-repressible promoter with linear lacI on a constitutive T7 promoter (no fluorescense)
  • LLG2 + LCL3 + 100 uM IPTG - GFP on a LacI-repressible promoter with lacI and IPTG present (fluoresce)

In addition, an RFP-based construct was developed, just in case I couldn't get access to BBa_I2035 and a constitutive T7-based lacI using a biobrick part:

  • PLR4 (T7-Plac:RBS:RFP) - plasmid DNA with RFP on a LacI-repressible promoter, PCR'd from plasmid provided by Karsten Temme at UCSF and inserted into Novagen pET vector. This can be used as a replacement for LLG2, if needed.
  • LCL5 (T7-RBS:lacI) - linear DNA with with LacI on a constitutive T7 promoter, constructed from BBa_2043. This can be used as a replacement for LCL3, if needed.

Naming scheme:

 * L/P - DNA type: linear DNA versus plasmid
 * C/L - promoter type: constitutive T7 promoter versus LacI-repressible
 * G/L/R - coding region: GFP, RFP or LacI

DNA construction

Only the BBa_I2035 plasmid is in the form needed for use with the PURE system. The other sequences were constructed using PCR-based editing.

PLG1

This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).

LLG2

This is linear DNA containing a lacI-repressible T7 promoter, extracted from BBa_I2035 using a simple forward and reverse primer. Use of this piece of DNA allows testing of linear DNA versus plasmid DNA.

The sequence for the relevant section of BBa_I2035, starting from the beginning of the promoter is

tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactagatgcgtaaaggagaagaact
tttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagat
acccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaa
gacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatg
gaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccct
ttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa
tactagagctagcataaccccttggggcctctaaacgggtcttgaggggttttttg
  • Forward primer: tcatacgactcactataggggaat
  • Reverse primer: aaacgggtcttgaggggttttttg

LCL3

This sequence consists of lacI on a constitutive T7-promoter. It is constructed by doing PCR amplification of lacI out of a BBa_I2043 plasmid and then attaching the T7 promoter and RBS using the PURExpress universal primer. Sequence for lacI (from BBa_K091121 - wild type lacI):

>BBa_K091121 Part-only sequence (1083 bp)
atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaa
cgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgc
cacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaa
cgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgcca
ttgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtac
gcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggc
tggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctga
atgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcgga
tatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagc
gtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaata
cgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtga
  • Round 1 forward primer:
  • Round 1 reverse primer:
  • Round 2 forward primer: PURExpress universal forward primer
  • Round 2 reverse primer: same as round 1 reverse primer

PLR4

This is a linear sequence of DNA that can be used as a replacement for LLG2, in case I can't get BBa_I2035. In order to get this sequence, I have to insert RFP into a pET vector (has a lacI-repressible T7 promoter) and grow up some cells.

LCL5

This is a substitute for LCL3 using the Novagen pLacI plasmid (in case I can't get BBa_I2043). The primers are identical to LCL3 since we are just grabbing a standard lacI gene. (Note: need to check there are no modifications to the sequences on the pLacI plasmid; if so, look for another source).


Personal tools