MurrayRM:PURExpress system notes and experience: Difference between revisions
(→LLG2) |
(→LCL3) |
||
Line 65: | Line 65: | ||
cgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtga | cgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtga | ||
</tt></blockquote> | </tt></blockquote> | ||
* | * RMM_LCL3_fwd_round1: TAACTTTAAGAAGGAGATATACCA atgaaaccagtaacgttatacg | ||
* | ** Based on specification in PURExpress manual, with start of lacI | ||
* RMM_LCL3_rev_round1: TATTCA tcactgcccgctttccagt | |||
** Based on specification in PURExpress manual | |||
* Round 2 forward primer: PURExpress universal forward primer | * Round 2 forward primer: PURExpress universal forward primer | ||
* Round 2 reverse primer: same as round 1 reverse primer | * Round 2 reverse primer: same as round 1 reverse primer |
Revision as of 15:20, 12 February 2010
Notes on using the NEB PURExpress system.
Worked example: inducible expression
To illustrate how the system works, I am going to try various combinations of three different constructs:
- PLG1 (BBa_I2035) - GFP with a LacI-repressible promoter on a plasmid
- LLG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035
- LCL3 (T7:RBS:lacI) - linear lacI on a constitutive T7 promoter
In addition, I may build up an RFP-based construct, just in case I can't get access to BBa_I2035:
- PLR4 (T7-Plac:RBS:RFP) - plasmid DNA with RFP on a LacI-repressible promoter, PCR'd from the purified RFP plasmid (based on plasmids provided by Karsten Temme at UCSF) and inserted into Novagen pET vector. This can be used as a replacement for PLG1, if needed.
Naming scheme:
- L/P - DNA type: linear DNA versus plasmid
- C/L - promoter type: constitutive T7 promoter versus LacI-repressible
- G/L/R - coding region: GFP, RFP or LacI
Using these components, I can try out the following "circuits":
- GFP expression on a lacI-repressible T7 promoter (with no lacI => should flouresence): PLG1 or LLG2
- This will allow a positive control to make sure that a T7 promoter with operator site still works
- Repression of GFP by lacI: PLG1/LLG2 + LCL3
- Induction of GFP using IPTG: PLG1/LLG2 + LCL3
DNA construction
Only the BBa_I2035 plasmid is in the form needed for use with the PURE system. The other sequences will be constructed using PCR-based editing.
PLG1
This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).
LLG2
This is linear DNA containing a lacI-repressible T7 promoter in front of GFP, extracted from BBa_I2035 using a simple forward and reverse primer. Use of this piece of DNA allows testing of linear DNA versus plasmid DNA.
The sequence for the relevant section of BBa_I2035, starting from the beginning of the promoter and going through the end of the terminator
>BBa_I2035 Part-only sequence (856 bp) tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactagatgcgtaaaggagaagaact tttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagat acccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaa gacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatg gaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccct ttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa tactagagctagcataaccccttggggcctctaaacgggtcttgaggggttttttg
- RMM_LLG2_fwd: tcatacgactcactataggggaat
- RMM_LLG2_rev: caaaaaacccctcaagacccgttt
LCL3
This sequence consists of lacI on a constitutive T7-promoter. It is constructed by doing PCR amplification of lacI out of a BBa_K091121 plasmid and then attaching the T7 promoter and RBS using the PURExpress universal primer. Sequence for lacI (from BBa_K091121 - wild type lacI):
>BBa_K091121 Part-only sequence (1083 bp) atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaa cgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgc cacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaa cgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgcca ttgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtac gcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggc tggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctga atgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcgga tatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagc gtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaata cgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtga
- RMM_LCL3_fwd_round1: TAACTTTAAGAAGGAGATATACCA atgaaaccagtaacgttatacg
- Based on specification in PURExpress manual, with start of lacI
- RMM_LCL3_rev_round1: TATTCA tcactgcccgctttccagt
- Based on specification in PURExpress manual
- Round 2 forward primer: PURExpress universal forward primer
- Round 2 reverse primer: same as round 1 reverse primer
PLR4
This is a linear sequence of DNA that can be used as a replacement for LLG2, in case I can't get BBa_I2035. In order to get this sequence, I have to insert RFP into a pET vector (has a lacI-repressible T7 promoter) and grow up some cells.
- Restriction enzymes to be used: TBD (waiting to find out which pET vectors we actually have available)
- BamH1: GGATCC
- XhoI: CTCGAG
- Forward primer: GGAA GGATCC atgcgtttcaaagttcg
- Reverse primer: GGAA CTCGAG ttattaagcaccggtggagt
LLG5
A linear sequence of DNA with a T7 LacI-repressible promoter followed by RBS and RFP. This will be constructed using PCR extension off of RFP.
RFP sequence (for Karsten's plasmid)
gaagacgttatcaaagagttc atgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa
T7:Plac:RBS sequence
tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag
- Forward primer: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag atgcgtttcaaagttcgtatgg
- Reverse primer: ttattaagcaccggtggagtgac