MurrayRM:PURExpress system notes and experience - Revision history

Murrayrm: /* LLR4 */

Murrayrm — Sat, 13 Feb 2010 00:17:45 GMT

LLR4

←Older revision		Revision as of 00:17, 13 February 2010
Line 91:		Line 91:
	</tt></blockquote>		</tt></blockquote>

-	* ~~RMM_LLR4_fwd~~: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag ATGTCCAGATTAGATAAAAG	+	* RMM_LLR4_fwd_oneshot: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag ATGTCCAGATTAGATAAAAG
	** Does not include the GAAAT sequence that is at the start of the PURE universal primer		** Does not include the GAAAT sequence that is at the start of the PURE universal primer
	* RMM_LLR4_rev: TATTCA ttattaagcaccggtggagtgac		* RMM_LLR4_rev: TATTCA ttattaagcaccggtggagtgac

Murrayrm: /* LCR6 */

Murrayrm — Sat, 13 Feb 2010 00:16:22 GMT

LCR6

←Older revision		Revision as of 00:16, 13 February 2010
Line 115:		Line 115:
	This is a linear sequence of DNA that pulls out RFP for use in the PURE system. Replacement for previous sequence that was not quite right.		This is a linear sequence of DNA that pulls out RFP for use in the PURE system. Replacement for previous sequence that was not quite right.

-	* RMM_LCR6_fwd_round1: TAACTTTAAGAAGGAGATATACCA ~~TGTCCAGATTAGATAAAAG~~ (43 bp, 30% GC)	+	* RMM_LCR6_fwd_round1: TAACTTTAAGAAGGAGATATACCA ATGTCCAGATTAGATAAAAG (44 bp, 30% GC)
	* RMM_LCR6_rev_round1: TATTCA ttattaagcaccggtggag (25 bp, 40% GC)		* RMM_LCR6_rev_round1: TATTCA ttattaagcaccggtggag (25 bp, 40% GC)

	</blockquote>		</blockquote>

Murrayrm at 00:13, 13 February 2010

Murrayrm — Sat, 13 Feb 2010 00:13:58 GMT

←Older revision		Revision as of 00:13, 13 February 2010
Line 91:		Line 91:
	</tt></blockquote>		</tt></blockquote>

-	* RMM_LLR4_fwd: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag ~~atgcgtttcaaagttcgtatgg~~	+	* RMM_LLR4_fwd: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag ATGTCCAGATTAGATAAAAG
	** Does not include the GAAAT sequence that is at the start of the PURE universal primer		** Does not include the GAAAT sequence that is at the start of the PURE universal primer
	* RMM_LLR4_rev: TATTCA ttattaagcaccggtggagtgac		* RMM_LLR4_rev: TATTCA ttattaagcaccggtggagtgac
Line 97:		Line 97:

	Alternative: do in two rounds		Alternative: do in two rounds
-	* RMM_LLR4_fwd_round1: tactagagtcacacaggaaagtactag ~~atgcgtttcaaagttcgtatgg~~ (49 bp, 41% GC)	+	* RMM_LLR4_fwd_round1: tactagagtcacacaggaaagtactag ATGTCCAGATTAGATAAAAG (47 bp, 36% GC)
	** Starts just after the lacI operator sites and goes through RBS, then beginning of RFP		** Starts just after the lacI operator sites and goes through RBS, then beginning of RFP
	* RMM_LLR4_fwd_round2: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcc tactagagtcacacagg (70 bp, 47% GC)		* RMM_LLR4_fwd_round2: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcc tactagagtcacacagg (70 bp, 47% GC)
Line 107:		Line 107:
	* BamH1: GGATCC		* BamH1: GGATCC
	* XhoI: CTCGAG		* XhoI: CTCGAG
-	* RMM_PLR5_fwd_BamH1: GGAA GGATCC ~~atgcgtttcaaagttcg~~	+	* RMM_PLR5_fwd_BamH1: GGAA GGATCC ATGTCCAGATTAGATAAAAG
	** Added GGAA to end of sequence per Simon		** Added GGAA to end of sequence per Simon
	* RMM_PLR5_rev_XhoI: GGAA CTCGAG ttattaagcaccggtggagt		* RMM_PLR5_rev_XhoI: GGAA CTCGAG ttattaagcaccggtggagt
Line 115:		Line 115:
	This is a linear sequence of DNA that pulls out RFP for use in the PURE system. Replacement for previous sequence that was not quite right.		This is a linear sequence of DNA that pulls out RFP for use in the PURE system. Replacement for previous sequence that was not quite right.

-	* RMM_LCR6_fwd_round1: TAACTTTAAGAAGGAGATATACCA ~~atgcgtttcaaagttcg~~ (41 bp, 34% GC)	+	* RMM_LCR6_fwd_round1: TAACTTTAAGAAGGAGATATACCA TGTCCAGATTAGATAAAAG (43 bp, 30% GC)
	* RMM_LCR6_rev_round1: TATTCA ttattaagcaccggtggag (25 bp, 40% GC)		* RMM_LCR6_rev_round1: TATTCA ttattaagcaccggtggag (25 bp, 40% GC)

	</blockquote>		</blockquote>

Murrayrm: /* LLR4 */

Murrayrm — Sat, 13 Feb 2010 00:10:49 GMT

LLR4

←Older revision		Revision as of 00:10, 13 February 2010
Line 78:		Line 78:
	RFP sequence (for Karsten's plasmid)		RFP sequence (for Karsten's plasmid)
	<blockquote><tt>		<blockquote><tt>
-	~~gaagacgttatcaaagagttc atgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagtta~~	+	ATGTCCAGATTAGATAAAAGTAAAGTTGCGAGCTCTgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcg
-	~~ccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtcct~~	+	aaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaa
-	~~tcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgc~~	+	agcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactc
-	~~gtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatca~~	+	ctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacc
-	~~aaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaact~~	+	cggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtg
-	~~ggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa~~	+	cttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa
	</tt></blockquote>		</tt></blockquote>

Murrayrm: /* LLG2 */

Murrayrm — Sat, 13 Feb 2010 00:00:24 GMT

LLG2

←Older revision		Revision as of 00:00, 13 February 2010
Line 30:		Line 30:
	This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).		This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).

-	==== LLG2 ====	+	==== LLG2 - linear LacI-repressible GFP ====
	This is linear DNA containing a lacI-repressible T7 promoter in front of GFP, extracted from BBa_I2035 using a simple forward and reverse primer. Use of this piece of DNA allows testing of linear DNA versus plasmid DNA.		This is linear DNA containing a lacI-repressible T7 promoter in front of GFP, extracted from BBa_I2035 using a simple forward and reverse primer. Use of this piece of DNA allows testing of linear DNA versus plasmid DNA.

Murrayrm: /* PLG1 */

Murrayrm — Sat, 13 Feb 2010 00:00:11 GMT

PLG1

←Older revision		Revision as of 00:00, 13 February 2010
Line 27:		Line 27:

	<blockquote>		<blockquote>
-	==== PLG1 ====	+	==== PLG1 - plasmid LacI-repressible GFP ====
	This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).		This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).

Murrayrm: /* LCR6 */

Murrayrm — Fri, 12 Feb 2010 23:54:28 GMT

LCR6

←Older revision		Revision as of 23:54, 12 February 2010
Line 115:		Line 115:
	This is a linear sequence of DNA that pulls out RFP for use in the PURE system. Replacement for previous sequence that was not quite right.		This is a linear sequence of DNA that pulls out RFP for use in the PURE system. Replacement for previous sequence that was not quite right.

-	* RMM_LCR6_fwd_round1: TAACTTTAAGAAGGAGATATACCA	+	* RMM_LCR6_fwd_round1: TAACTTTAAGAAGGAGATATACCA atgcgtttcaaagttcg (41 bp, 34% GC)
-	* RMM_LCR6_rev_round1:	+	* RMM_LCR6_rev_round1: TATTCA ttattaagcaccggtggag (25 bp, 40% GC)

	</blockquote>		</blockquote>

Murrayrm: /* PLR5 */

Murrayrm — Fri, 12 Feb 2010 23:50:43 GMT

PLR5

←Older revision		Revision as of 23:50, 12 February 2010
Line 111:		Line 111:
	* RMM_PLR5_rev_XhoI: GGAA CTCGAG ttattaagcaccggtggagt		* RMM_PLR5_rev_XhoI: GGAA CTCGAG ttattaagcaccggtggagt
	** Added GGAA to end of sequence per Simon		** Added GGAA to end of sequence per Simon
		+
		+	==== LCR6 ====
		+	This is a linear sequence of DNA that pulls out RFP for use in the PURE system. Replacement for previous sequence that was not quite right.
		+
		+	* RMM_LCR6_fwd_round1: TAACTTTAAGAAGGAGATATACCA
		+	* RMM_LCR6_rev_round1:

	</blockquote>		</blockquote>

Murrayrm: /* LLR4 */

Murrayrm — Fri, 12 Feb 2010 23:48:02 GMT

LLR4

←Older revision		Revision as of 23:48, 12 February 2010
Line 78:		Line 78:
	RFP sequence (for Karsten's plasmid)		RFP sequence (for Karsten's plasmid)
	<blockquote><tt>		<blockquote><tt>
-	gaagacgttatcaaagagttc atgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa	+	gaagacgttatcaaagagttc atgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagtta
		+	ccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtcct
		+	tcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgc
		+	gtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatca
		+	aaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaact
		+	ggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa
	</tt></blockquote>		</tt></blockquote>

Line 90:		Line 95:
	* RMM_LLR4_rev: TATTCA ttattaagcaccggtggagtgac		* RMM_LLR4_rev: TATTCA ttattaagcaccggtggagtgac
	** Initial sequence based on specification in PURExpress manual		** Initial sequence based on specification in PURExpress manual
		+
		+	Alternative: do in two rounds
		+	* RMM_LLR4_fwd_round1: tactagagtcacacaggaaagtactag atgcgtttcaaagttcgtatgg (49 bp, 41% GC)
		+	** Starts just after the lacI operator sites and goes through RBS, then beginning of RFP
		+	* RMM_LLR4_fwd_round2: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcc tactagagtcacacagg (70 bp, 47% GC)
		+	** Includes the T7 promoter, through the lacI operator site and overlaps with the RBS sequence

	==== PLR5 ====		==== PLR5 ====

Murrayrm: /* Worked example: inducible expression */

Murrayrm — Fri, 12 Feb 2010 22:32:20 GMT

Worked example: inducible expression

←Older revision		Revision as of 22:32, 12 February 2010
Line 7:		Line 7:
	* LLG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035		* LLG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035
	* LCL3 (T7:RBS:lacI) - linear lacI on a constitutive T7 promoter		* LCL3 (T7:RBS:lacI) - linear lacI on a constitutive T7 promoter
-	In addition, I may build up an RFP-based construct, just in case I can't get access to BBa_I2035:	+	In addition, I may build up an RFP-based construct, just in case I can't get access to BBa_I2035. This requires two additional constructs:
-	* ~~PLR4~~ (T7-Plac:RBS:RFP) - plasmid DNA with RFP on a LacI-repressible promoter, PCR'd from the purified RFP plasmid (based on plasmids provided by Karsten Temme at UCSF) and inserted into Novagen pET vector. This can be used as a replacement for PLG1, if needed.	+	* LLR4 (T7-Plac:RBS:RFP) - linear DNA with RFP on a LacI-repressible promoter, PCR'd from the purified RFP plasmid (based on plasmids provided by Karsten Temme at UCSF), created by extension PCR
		+	* PLR5 (T7-Plac:RBS:RFP) - plasmid DNA with RFP on a LacI-repressible promoter, PCR'd from the purified RFP plasmid (based on plasmids provided by Karsten Temme at UCSF) and inserted into Novagen pET vector. This can be used as a replacement for PLG1, if needed.

	Naming scheme:		Naming scheme:
Line 72:		Line 73:
	* Round 2 reverse primer: same as round 1 reverse primer		* Round 2 reverse primer: same as round 1 reverse primer

-	==== ~~PLR4 ====~~	+	==== LLR4 ====
-	This is a linear sequence of DNA that can be used as a replacement for LLG2, in case I can't get BBa_I2035. In order to get this sequence, I have to insert RFP into a pET vector (has a lacI-repressible T7 promoter) and grow up some cells.	+
-	* Restriction enzymes to be used: TBD (waiting to find out which pET vectors we actually have available)	+
-	* BamH1: GGATCC	+
-	* XhoI: CTCGAG	+
-	* RMM_PLR4_fwd_BamH1: GGAA GGATCC atgcgtttcaaagttcg	+
-	** Added GGAA to end of sequence per Simon	+
-	* RMM_PLR4_rev_XhoI: GGAA CTCGAG ttattaagcaccggtggagt	+
-	** Added GGAA to end of sequence per Simon	+
-		+
-	~~==== LLG5~~ ====	+
	A linear sequence of DNA with a T7 LacI-repressible promoter followed by RBS and RFP. This will be constructed using PCR extension off of RFP.		A linear sequence of DNA with a T7 LacI-repressible promoter followed by RBS and RFP. This will be constructed using PCR extension off of RFP.

Line 95:		Line 86:
	</tt></blockquote>		</tt></blockquote>

-	* ~~Forward primer~~: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag atgcgtttcaaagttcgtatgg	+	* RMM_LLR4_fwd: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag atgcgtttcaaagttcgtatgg
-	* ~~Reverse~~ primer: ttattaagcaccggtggagtgac	+	** Does not include the GAAAT sequence that is at the start of the PURE universal primer
		+	* RMM_LLR4_rev: TATTCA ttattaagcaccggtggagtgac
		+	** Initial sequence based on specification in PURExpress manual
		+
		+	==== PLR5 ====
		+	This is a linear sequence of DNA that can be used as a replacement for LLG2, in case I can't get BBa_I2035. In order to get this sequence, I have to insert RFP into a pET vector (has a lacI-repressible T7 promoter) and grow up some cells.
		+	* Restriction enzymes to be used: TBD (waiting to find out which pET vectors we actually have available)
		+	* BamH1: GGATCC
		+	* XhoI: CTCGAG
		+	* RMM_PLR5_fwd_BamH1: GGAA GGATCC atgcgtttcaaagttcg
		+	** Added GGAA to end of sequence per Simon
		+	* RMM_PLR5_rev_XhoI: GGAA CTCGAG ttattaagcaccggtggagt
		+	** Added GGAA to end of sequence per Simon

	</blockquote>		</blockquote>