MurrayRM:PURExpress system notes and experience

From OpenWetWare
Revision as of 17:16, 12 February 2010 by Murrayrm (talk | contribs) (→‎LCR6)
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

Notes on using the NEB PURExpress system.

Worked example: inducible expression

To illustrate how the system works, I am going to try various combinations of three different constructs:

  • PLG1 (BBa_I2035) - GFP with a LacI-repressible promoter on a plasmid
  • LLG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035
  • LCL3 (T7:RBS:lacI) - linear lacI on a constitutive T7 promoter

In addition, I may build up an RFP-based construct, just in case I can't get access to BBa_I2035. This requires two additional constructs:

  • LLR4 (T7-Plac:RBS:RFP) - linear DNA with RFP on a LacI-repressible promoter, PCR'd from the purified RFP plasmid (based on plasmids provided by Karsten Temme at UCSF), created by extension PCR
  • PLR5 (T7-Plac:RBS:RFP) - plasmid DNA with RFP on a LacI-repressible promoter, PCR'd from the purified RFP plasmid (based on plasmids provided by Karsten Temme at UCSF) and inserted into Novagen pET vector. This can be used as a replacement for PLG1, if needed.

Naming scheme:

  • L/P - DNA type: linear DNA versus plasmid
  • C/L - promoter type: constitutive T7 promoter versus LacI-repressible
  • G/L/R - coding region: GFP, RFP or LacI

Using these components, I can try out the following "circuits":

  • GFP expression on a lacI-repressible T7 promoter (with no lacI => should flouresence): PLG1 or LLG2
This will allow a positive control to make sure that a T7 promoter with operator site still works
  • Repression of GFP by lacI: PLG1/LLG2 + LCL3
  • Induction of GFP using IPTG: PLG1/LLG2 + LCL3

DNA construction

Only the BBa_I2035 plasmid is in the form needed for use with the PURE system. The other sequences will be constructed using PCR-based editing.

PLG1 - plasmid LacI-repressible GFP

This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).

LLG2 - linear LacI-repressible GFP

This is linear DNA containing a lacI-repressible T7 promoter in front of GFP, extracted from BBa_I2035 using a simple forward and reverse primer. Use of this piece of DNA allows testing of linear DNA versus plasmid DNA.

The sequence for the relevant section of BBa_I2035, starting from the beginning of the promoter and going through the end of the terminator

>BBa_I2035 Part-only sequence (856 bp) tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactagatgcgtaaaggagaagaact tttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagat acccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaa gacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatg gaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccct ttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa tactagagctagcataaccccttggggcctctaaacgggtcttgaggggttttttg

  • RMM_LLG2_fwd: tcatacgactcactataggggaat
  • RMM_LLG2_rev: caaaaaacccctcaagacccgttt

LCL3

This sequence consists of lacI on a constitutive T7-promoter. It is constructed by doing PCR amplification of lacI out of a BBa_K091121 plasmid and then attaching the T7 promoter and RBS using the PURExpress universal primer. Sequence for lacI (from BBa_K091121 - wild type lacI):

>BBa_K091121 Part-only sequence (1083 bp) atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaa cgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgc cacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaa cgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgcca ttgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtac gcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggc tggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctga atgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcgga tatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagc gtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaata cgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtga

  • RMM_LCL3_fwd_round1: TAACTTTAAGAAGGAGATATACCA atgaaaccagtaacgttatacg
    • Based on specification in PURExpress manual, with start of lacI
  • RMM_LCL3_rev_round1: TATTCA tcactgcccgctttccagt
    • Based on specification in PURExpress manual
  • Round 2 forward primer: PURExpress universal forward primer
  • Round 2 reverse primer: same as round 1 reverse primer

LLR4

A linear sequence of DNA with a T7 LacI-repressible promoter followed by RBS and RFP. This will be constructed using PCR extension off of RFP.

RFP sequence (for Karsten's plasmid)

ATGTCCAGATTAGATAAAAGTAAAGTTGCGAGCTCTgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcg aaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaa agcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactc ctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacc cggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtg cttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa

T7:Plac:RBS sequence

tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag

  • RMM_LLR4_fwd: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag ATGTCCAGATTAGATAAAAG
    • Does not include the GAAAT sequence that is at the start of the PURE universal primer
  • RMM_LLR4_rev: TATTCA ttattaagcaccggtggagtgac
    • Initial sequence based on specification in PURExpress manual

Alternative: do in two rounds

  • RMM_LLR4_fwd_round1: tactagagtcacacaggaaagtactag ATGTCCAGATTAGATAAAAG (47 bp, 36% GC)
    • Starts just after the lacI operator sites and goes through RBS, then beginning of RFP
  • RMM_LLR4_fwd_round2: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcc tactagagtcacacagg (70 bp, 47% GC)
    • Includes the T7 promoter, through the lacI operator site and overlaps with the RBS sequence

PLR5

This is a linear sequence of DNA that can be used as a replacement for LLG2, in case I can't get BBa_I2035. In order to get this sequence, I have to insert RFP into a pET vector (has a lacI-repressible T7 promoter) and grow up some cells.

  • Restriction enzymes to be used: TBD (waiting to find out which pET vectors we actually have available)
  • BamH1: GGATCC
  • XhoI: CTCGAG
  • RMM_PLR5_fwd_BamH1: GGAA GGATCC ATGTCCAGATTAGATAAAAG
    • Added GGAA to end of sequence per Simon
  • RMM_PLR5_rev_XhoI: GGAA CTCGAG ttattaagcaccggtggagt
    • Added GGAA to end of sequence per Simon

LCR6

This is a linear sequence of DNA that pulls out RFP for use in the PURE system. Replacement for previous sequence that was not quite right.

  • RMM_LCR6_fwd_round1: TAACTTTAAGAAGGAGATATACCA ATGTCCAGATTAGATAAAAG (44 bp, 30% GC)
  • RMM_LCR6_rev_round1: TATTCA ttattaagcaccggtggag (25 bp, 40% GC)
Retrieved from "https://openwetware.org/mediawiki/index.php?title=MurrayRM:PURExpress_system_notes_and_experience&oldid=390975"