NanoBio: Commonly Used Primers

From OpenWetWare
Revision as of 11:44, 17 June 2008 by CarolineAjo-Franklin (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

Commonly Used Primers

  • Sequencing primers for Biobrick & Biofusion vectors:
    • pSB1A3, pSB1AC3, pSB1AK3, pSB1AT3 forward primer(AF009): 5' AAATAGGCGTATCACGAGGC 3'
    • pSB1A3, pSB1AC3, pSB1AK3, pSB1AT3 reverse primer (AF010): 5' GAGTCAGTGAGCGAGGAAGC 3'
    • V0100/V0120 forward sequencing primer (AF039): 5' GGGTTTTCCCAGTCACGACG 3'
    • V0100/V0120 reverse sequencing primer (AF040): 5' TGTGGAATTGTGAGCGGATAACA 3'
    • V0002 forward sequencing primer: 5' tttctggaattcgcggcc 3'
    • V0002 reverse sequencing primer: 5' gccggactgcagcggcc 3'
  • Primers that sequence regions between the Biobrick ends
    • upstream of a Kozak region (K0001): 5' TCTAGTCTCCATGGTGGCGG 3'
    • downstream of a Kozak region (K0001): 5' CCGCCACCATGGAGACTAGA 3'
    • upstream of the ADH1 terminator (L0100): 5' CCTGAGAAAGCAACCTGACCTACAG 3'
    • downstream of midpoint btwn yeast-codon optimized YFP/mCherryx2 (Z0035 or Z0037): 5' GGTACCGCAACTAGAGCAACTAGC 3'
    • upstream of midpoint btwn yeast-codon optimized YFP/mCherryx2(Z0035 or Z0037): 5' GCTAGTTGCTCTAGTTGCGGTACC 3'
  • Sequencing primers for other vectors
    • pET vectors 5' atgcgtccggcgtaga
    • T7 promoter 5' taatacgactcactataggg
    • T7 terminator 5' gctagttattgctcagcgg
  • CAjoF 18:44, 17 June 2008 (UTC)
Retrieved from "https://openwetware.org/mediawiki/index.php?title=NanoBio:_Commonly_Used_Primers&oldid=212974"