NanoBio: Primer Design: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 11: Line 11:


First, find the sequence of your gene(s) including '''''50 bases upstream''''' and '''50 bases downstream'''.  
First, find the sequence of your gene(s) including '''''50 bases upstream''''' and '''50 bases downstream'''.  
#*NapC is on the antisense strand, so this sequence is the reverse complement of the coding sequence. It doesn't matter which way you look at it though! Do whatever is easiest for you to look at.
*NapC is on the antisense strand, so this sequence is the reverse complement of the coding sequence. It doesn't matter which way you look at it though! Do whatever is easiest for you to look at.
#*The start and stop codon below are in lower case.
*The start and stop codon below are in lower case.
#*NapC is 603bp
*NapC is 603bp
 
:''Note here that that 50 bases flanking the start and stop codon will be a part of the PCR primer. This is the portion that will change depending on what you would like to delete from the genome.''


'''''CGCTCACAAAGTAACTCTCTGGCTTCAAGCATACCCACGCAATAACCCTG'''''
'''''CGCTCACAAAGTAACTCTCTGGCTTCAAGCATACCCACGCAATAACCCTG'''''
Line 44: Line 46:


Second, let's take a look at pKD4. This (or pKD3) is the plasmid that you will be doing the PCR amplification from. For a clearer view of the plasmid, open the file for pKD4 in Vector NTI.  
Second, let's take a look at pKD4. This (or pKD3) is the plasmid that you will be doing the PCR amplification from. For a clearer view of the plasmid, open the file for pKD4 in Vector NTI.  
#*FLP sequences appear as '''upper case bold'''
*FLP sequences appear as '''upper case bold'''
#*Primer sequences appear as lower case bold/italic for '''''upstream''''' and lower case bold for '''downstream'''
*Primer sequences appear as lower case bold/italic for '''''upstream''''' and lower case bold for '''downstream'''
#*In this case we're looking at KanR which will be in regular text, all caps, except for the ''stop/start codons''.
*In this case we're looking at KanR which will be in regular text, all caps, except for the ''stop/start codons''.
 
:''Just to take note, the FLP sites are essential if you would like to remove the antibiotic resistance after you've made the knockout. The primer sequences shown below are good for the plasmid portion of the PCR primers in '''ALL''' cases (even if using pKD3).''


'''''gtgtaggctggagctgcttc''''' '''GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTC'''
'''''gtgtaggctggagctgcttc''''' '''GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTC'''
Line 89: Line 93:


'''TAGGAACTTCGGAATAGGAACT''' aaggaggatattcatat '''''ggaccatggctaattcccat'''''
'''TAGGAACTTCGGAATAGGAACT''' aaggaggatattcatat '''''ggaccatggctaattcccat'''''
----
So now we will "cut and paste" the important parts of each piece to make our primers!


==Primer Set 2==
==Primer Set 2==

Revision as of 13:11, 9 June 2009

Primer Design

You will need 4 primers per knockout that you design.

  • 2 will be for the PCR to clone out the antibiotic resistance. These are 70 bases long.
  • The other 2 are for verifying knockouts with colony PCR. These are 25 bases long.

Primer Set 1

This is the trickier set. Be careful! I will use NapC from E. coli as an example here.

First, find the sequence of your gene(s) including 50 bases upstream and 50 bases downstream.

  • NapC is on the antisense strand, so this sequence is the reverse complement of the coding sequence. It doesn't matter which way you look at it though! Do whatever is easiest for you to look at.
  • The start and stop codon below are in lower case.
  • NapC is 603bp
Note here that that 50 bases flanking the start and stop codon will be a part of the PCR primer. This is the portion that will change depending on what you would like to delete from the genome.

CGCTCACAAAGTAACTCTCTGGCTTCAAGCATACCCACGCAATAACCCTG

ttaAAAACCTGGCTCGACTTCACGCATATCGGGCAGCTTGTGCGCTATCCCTTTATGGCAATCAATACAGG

TTTGCCCATCTTTCACCGCCTGGTCATGCATCTTCGCGGCAACCGATTTCTGGGCGGTTGTATCCATATAC

TCGAAGTTGTGACAGTTACGGCACTCCTGCGAGTTATTGTCCTTCATGCGCCGCCACTCATTCTGTGCCAT

CGTCAGACGATGAGCTTCAAATTTCTGCGGCGTGTCAATAACGCCAAAAATTTTACCATACAGCTCTTTAC

TTGCTTTGAGCTTGCGTATCATCTTCGGCACAAACTCGTGCGGAACGTGACAATCCGGACAGGTCGCACG

GACGCCGCTACGGTTGTTGTAGTGCACGGAATCCATGTATTCCTGATACACCGTGTTGCGCATTTCGTGG

CAGCTAATGCAGAACTCTTCGGTATTGGCTTTTTCCATCCCGGTGTTAAAGCCACCCCAGAAGACGATGC

CGCCAACAAAACCGATCAACAGCAGCGTCCCCAGCGCCAGACGGCTGGGGGTACGCCACCATTTCCAC

AGGCGCTTAATCAGACCAGGCTTACGGTCAGAATTTCCCATAATAACCTCTTATTTCCCGTAACCTTTTGA

TGGGGTAAAGGTATTCCcat

AATAACCTCTTATTTCCCGTAACCTTTTGATGGGGTAAAGGTATTCCCCA




Second, let's take a look at pKD4. This (or pKD3) is the plasmid that you will be doing the PCR amplification from. For a clearer view of the plasmid, open the file for pKD4 in Vector NTI.

  • FLP sequences appear as upper case bold
  • Primer sequences appear as lower case bold/italic for upstream and lower case bold for downstream
  • In this case we're looking at KanR which will be in regular text, all caps, except for the stop/start codons.
Just to take note, the FLP sites are essential if you would like to remove the antibiotic resistance after you've made the knockout. The primer sequences shown below are good for the plasmid portion of the PCR primers in ALL cases (even if using pKD3).

gtgtaggctggagctgcttc GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTC

aagatcccctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaa

cggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcag

tgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttg

ggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatg

aggatcgtttcgcatgATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGC

TATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCA

GCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGG

ACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACG

TTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTC

ATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGC

TTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCG

GATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGC

CGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGG

CGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCC

GGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCT

TGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGC

ATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCtgagcgggactctggggttcgaaatgaccgaccaagcgacgccc

aacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcct

ccagcgcggggatctcatgctggagttcttcgcccaccccagcttcaaaagcgctctGAAGTTCCTATACTTTCTAGAGAA

TAGGAACTTCGGAATAGGAACT aaggaggatattcatat ggaccatggctaattcccat




So now we will "cut and paste" the important parts of each piece to make our primers!

Primer Set 2

This is the easier set! Just copy and paste the fist 25 bases of each of the above primers, and you're done!


--Heather M. Jensen 14:52, 9 June 2009 (EDT)

Return to Protocols.