PCP05

From OpenWetWare

Revision as of 11:32, 30 August 2006 by Crp724 (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

comments: pCP05 - pTG3602 cut with AscI and religated to produce Fiber shuttle, wtAd5 with a deletion from 15671bp-25290bp. ie no hexon, only NdeI site is in Fiber

sequence:

CATCATCAATAATATACCTTATTTTGGATTGAAGCCAATATGATAATGAG GGGGTGGAGTTTGTGACGTGGCGCGGGGCGTGGGAACGGGGCGGGTGACG TAGTAGTGTGGCGGAAGTGTGATGTTGCAAGTGTGGCGGAACACATGTAA GCGACGGATGTGGCAAAAGTGACGTTTTTGGTGTGCGCCGGTGTACACAG GAAGTGACAATTTTCGCGCGGTTTTAGGCGGATGTTGTAGTAAATTTGGG CGTAACCGAGTAAGATTTGGCCATTTTCGCGGGAAAACTGAATAAGAGGA AGTGAAATCTGAATAATTTTGTGTTACTCATAGCGCGTAATATTTGTCTA GGGCCGCGGGGACTTTGACCGTTTACGTGGAGACTCGCCCAGGTGTTTTT CTCAGGTGTTTTCCGCGTTCCGGGTCAAAGTTGGCGTTTTATTATTATAG TCAGCTGACGTGTAGTGTATTTATACCCGGTGAGTTCCTCAAGAGGCCAC TCTTGAGTGCCAGCGAGTAGAGTTTTCTCCTCCGAGCCGCTCCGACACCG GGACTGAAAATGAGACATATTATCTGCCACGGAGGTGTTATTACCGAAGA AATGGCCGCCAGTCTTTTGGACCAGCTGATCGAAGAGGTACTGGCTGATA ATCTTCCACCTCCTAGCCATTTTGAACCACCTACCCTTCACGAACTGTAT GATTTAGACGTGACGGCCCCCGAAGATCCCAACGAGGAGGCGGTTTCGCA GATTTTTCCCGACTCTGTAATGTTGGCGGTGCAGGAAGGGATTGACTTAC TCACTTTTCCGCCGGCGCCCGGTTCTCCGGAGCCGCCTCACCTTTCCCGG CAGCCCGAGCAGCCGGAGCAGAGAGCCTTGGGTCCGGTTTCTATGCCAAA CCTTGTACCGGAGGTGATCGATCTTACCTGCCACGAGGCTGGCTTTCCAC CCAGTGACGACGAGGATGAAGAGGGTGAGGAGTTTGTGTTAGATTATGTG GAGCACCCCGGGCACGGTTGCAGGTCTTGTCATTATCACCGGAGGAATAC GGGGGACCCAGATATTATGTGTTCGCTTTGCTATATGAGGACCTGTGGCA TGTTTGTCTACAGTAAGTGAAAATTATGGGCAGTGGGTGATAGAGTGGTG GGTTTGGTGTGGTAATTTTTTTTTTAATTTTTACAGTTTTGTGGTTTAAA GAATTTTGTATTGTGATTTTTTTAAAAGGTCCTGTGTCTGAACCTGAGCC TGAGCCCGAGCCAGAACCGGAGCCTGCAAGACCTACCCGCCGTCCTAAAA TGGCGCCTGCTATCCTGAGACGCCCGACATCACCTGTGTCTAGAGAATGC AATAGTAGTACGGATAGCTGTGACTCCGGTCCTTCTAACACACCTCCTGA GATACACCCGGTGGTCCCGCTGTGCCCCATTAAACCAGTTGCCGTGAGAG TTGGTGGGCGTCGCCAGGCTGTGGAATGTATCGAGGACTTGCTTAACGAG CCTGGGCAACCTTTGGACTTGAGCTGTAAACGCCCCAGGCCATAAGGTGT AAACCTGTGATTGCGTGTGTGGTTAACGCCTTTGTTTGCTGAATGAGTTG ATGTAAGTTTAATAAAGGGTGAGATAATGTTTAACTTGCATGGCGTGTTA AATGGGGCGGGGCTTAAAGGGTATATAATGCGCCGTGGGCTAATCTTGGT TACATCTGACCTCATGGAGGCTTGGGAGTGTTTGGAAGATTTTTCTGCTG TGCGTAACTTGCTGGAACAGAGCTCTAACAGTACCTCTTGGTTTTGGAGG TTTCTGTGGGGCTCATCCCAGGCAAAGTTAGTCTGCAGAATTAAGGAGGA TTACAAGTGGGAATTTGAAGAGCTTTTGAAATCCTGTGGTGAGCTGTTTG ATTCTTTGAATCTGGGTCACCAGGCGCTTTTCCAAGAGAAGGTCATCAAG ACTTTGGATTTTTCCACACCGGGGCGCGCTGCGGCTGCTGTTGCTTTTTT GAGTTTTATAAAGGATAAATGGAGCGAAGAAACCCATCTGAGCGGGGGGT ACCTGCTGGATTTTCTGGCCATGCATCTGTGGAGAGCGGTTGTGAGACAC AAGAATCGCCTGCTACTGTTGTCTTCCGTCCGCCCGGCGATAATACCGAC GGAGGAGCAGCAGCAGCAGCAGGAGGAAGCCAGGCGGCGGCGGCAGGAGC AGAGCCCATGGAACCCGAGAGCCGGCCTGGACCCTCGGGAATGAATGTTG TACAGGTGGCTGAACTGTATCCAGAACTGAGACGCATTTTGACAATTACA GAGGATGGGCAGGGGCTAAAGGGGGTAAAGAGGGAGCGGGGGGCTTGTGA GGCTACAGAGGAGGCTAGGAATCTAGCTTTTAGCTTAATGACCAGACACC GTCCTGAGTGTATTACTTTTCAACAGATCAAGGATAATTGCGCTAATGAG CTTGATCTGCTGGCGCAGAAGTATTCCATAGAGCAGCTGACCACTTACTG GCTGCAGCCAGGGGATGATTTTGAGGAGGCTATTAGGGTATATGCAAAGG TGGCACTTAGGCCAGATTGCAAGTACAAGATCAGCAAACTTGTAAATATC AGGAATTGTTGCTACATTTCTGGGAACGGGGCCGAGGTGGAGATAGATAC GGAGGATAGGGTGGCCTTTAGATGTAGCATGATAAATATGTGGCCGGGGG TGCTTGGCATGGACGGGGTGGTTATTATGAATGTAAGGTTTACTGGCCCC AATTTTAGCGGTACGGTTTTCCTGGCCAATACCAACCTTATCCTACACGG TGTAAGCTTCTATGGGTTTAACAATACCTGTGTGGAAGCCTGGACCGATG TAAGGGTTCGGGGCTGTGCCTTTTACTGCTGCTGGAAGGGGGTGGTGTGT CGCCCCAAAAGCAGGGCTTCAATTAAGAAATGCCTCTTTGAAAGGTGTAC CTTGGGTATCCTGTCTGAGGGTAACTCCAGGGTGCGCCACAATGTGGCCT CCGACTGTGGTTGCTTCATGCTAGTGAAAAGCGTGGCTGTGATTAAGCAT AACATGGTATGTGGCAACTGCGAGGACAGGGCCTCTCAGATGCTGACCTG CTCGGACGGCAACTGTCACCTGCTGAAGACCATTCACGTAGCCAGCCACT CTCGCAAGGCCTGGCCAGTGTTTGAGCATAACATACTGACCCGCTGTTCC TTGCATTTGGGTAACAGGAGGGGGGTGTTCCTACCTTACCAATGCAATTT GAGTCACACTAAGATATTGCTTGAGCCCGAGAGCATGTCCAAGGTGAACC TGAACGGGGTGTTTGACATGACCATGAAGATCTGGAAGGTGCTGAGGTAC GATGAGACCCGCACCAGGTGCAGACCCTGCGAGTGTGGCGGTAAACATAT TAGGAACCAGCCTGTGATGCTGGATGTGACCGAGGAGCTGAGGCCCGATC ACTTGGTGCTGGCCTGCACCCGCGCTGAGTTTGGCTCTAGCGATGAAGAT ACAGATTGAGGTACTGAAATGTGTGGGCGTGGCTTAAGGGTGGGAAAGAA TATATAAGGTGGGGGTCTTATGTAGTTTTGTATCTGTTTTGCAGCAGCCG CCGCCGCCATGAGCACCAACTCGTTTGATGGAAGCATTGTGAGCTCATAT TTGACAACGCGCATGCCCCCATGGGCCGGGGTGCGTCAGAATGTGATGGG CTCCAGCATTGATGGTCGCCCCGTCCTGCCCGCAAACTCTACTACCTTGA CCTACGAGACCGTGTCTGGAACGCCGTTGGAGACTGCAGCCTCCGCCGCC GCTTCAGCCGCTGCAGCCACCGCCCGCGGGATTGTGACTGACTTTGCTTT CCTGAGCCCGCTTGCAAGCAGTGCAGCTTCCCGTTCATCCGCCCGCGATG ACAAGTTGACGGCTCTTTTGGCACAATTGGATTCTTTGACCCGGGAACTT AATGTCGTTTCTCAGCAGCTGTTGGATCTGCGCCAGCAGGTTTCTGCCCT GAAGGCTTCCTCCCCTCCCAATGCGGTTTAAAACATAAATAAAAAACCAG ACTCTGTTTGGATTTGGATCAAGCAAGTGTCTTGCTGTCTTTATTTAGGG GTTTTGCGCGCGCGGTAGGCCCGGGACCAGCGGTCTCGGTCGTTGAGGGT CCTGTGTATTTTTTCCAGGACGTGGTAAAGGTGACTCTGGATGTTCAGAT ACATGGGCATAAGCCCGTCTCTGGGGTGGAGGTAGCACCACTGCAGAGCT TCATGCTGCGGGGTGGTGTTGTAGATGATCCAGTCGTAGCAGGAGCGCTG GGCGTGGTGCCTAAAAATGTCTTTCAGTAGCAAGCTGATTGCCAGGGGCA GGCCCTTGGTGTAAGTGTTTACAAAGCGGTTAAGCTGGGATGGGTGCATA CGTGGGGATATGAGATGCATCTTGGACTGTATTTTTAGGTTGGCTATGTT CCCAGCCATATCCCTCCGGGGATTCATGTTGTGCAGAACCACCAGCACAG TGTATCCGGTGCACTTGGGAAATTTGTCATGTAGCTTAGAAGGAAATGCG TGGAAGAACTTGGAGACGCCCTTGTGACCTCCAAGATTTTCCATGCATTC GTCCATAATGATGGCAATGGGCCCACGGGCGGCGGCCTGGGCGAAGATAT TTCTGGGATCACTAACGTCATAGTTGTGTTCCAGGATGAGATCGTCATAG GCCATTTTTACAAAGCGCGGGCGGAGGGTGCCAGACTGCGGTATAATGGT TCCATCCGGCCCAGGGGCGTAGTTACCCTCACAGATTTGCATTTCCCACG CTTTGAGTTCAGATGGGGGGATCATGTCTACCTGCGGGGCGATGAAGAAA ACGGTTTCCGGGGTAGGGGAGATCAGCTGGGAAGAAAGCAGGTTCCTGAG CAGCTGCGACTTACCGCAGCCGGTGGGCCCGTAAATCACACCTATTACCG GCTGCAACTGGTAGTTAAGAGAGCTGCAGCTGCCGTCATCCCTGAGCAGG GGGGCCACTTCGTTAAGCATGTCCCTGACTCGCATGTTTTCCCTGACCAA ATCCGCCAGAAGGCGCTCGCCGCCCAGCGATAGCAGTTCTTGCAAGGAAG CAAAGTTTTTCAACGGTTTGAGACCGTCCGCCGTAGGCATGCTTTTGAGC GTTTGACCAAGCAGTTCCAGGCGGTCCCACAGCTCGGTCACCTGCTCTAC GGCATCTCGATCCAGCATATCTCCTCGTTTCGCGGGTTGGGGCGGCTTTC GCTGTACGGCAGTAGTCGGTGCTCGTCCAGACGGGCCAGGGTCATGTCTT TCCACGGGCGCAGGGTCCTCGTCAGCGTAGTCTGGGTCACGGTGAAGGGG TGCGCTCCGGGCTGCGCGCTGGCCAGGGTGCGCTTGAGGCTGGTCCTGCT GGTGCTGAAGCGCTGCCGGTCTTCGCCCTGCGCGTCGGCCAGGTAGCATT TGACCATGGTGTCATAGTCCAGCCCCTCCGCGGCGTGGCCCTTGGCGCGC AGCTTGCCCTTGGAGGAGGCGCCGCACGAGGGGCAGTGCAGACTTTTGAG GGCGTAGAGCTTGGGCGCGAGAAATACCGATTCCGGGGAGTAGGCATCCG CGCCGCAGGCCCCGCAGACGGTCTCGCATTCCACGAGCCAGGTGAGCTCT GGCCGTTCGGGGTCAAAAACCAGGTTTCCCCCATGCTTTTTGATGCGTTT CTTACCTCTGGTTTCCATGAGCCGGTGTCCACGCTCGGTGACGAAAAGGC TGTCCGTGTCCCCGTATACAGACTTGAGAGGCCTGTCCTCGAGCGGTGTT CCGCGGTCCTCCTCGTATAGAAACTCGGACCACTCTGAGACAAAGGCTCG CGTCCAGGCCAGCACGAAGGAGGCTAAGTGGGAGGGGTAGCGGTCGTTGT CCACTAGGGGGTCCACTCGCTCCAGGGTGTGAAGACACATGTCGCCCTCT TCGGCATCAAGGAAGGTGATTGGTTTGTAGGTGTAGGCCACGTGACCGGG TGTTCCTGAAGGGGGGCTATAAAAGGGGGTGGGGGCGCGTTCGTCCTCAC TCTCTTCCGCATCGCTGTCTGCGAGGGCCAGCTGTTGGGGTGAGTACTCC CTCTGAAAAGCGGGCATGACTTCTGCGCTAAGATTGTCAGTTTCCAAAAA CGAGGAGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGG CCGCATCCATCTGGTCAGAAAAGACAATCTTTTTGTTGTCAAGCTTGGTG GCAAACGACCCGTAGAGGGCGTTGGACAGCAACTTGGCGATGGAGCGCAG GGTTTGGTTTTTGTCGCGATCGGCGCGCTCCTTGGCCGCGATGTTTAGCT GCACGTATTCGCGCGCAACGCACCGCCATTCGGGAAAGACGGTGGTGCGC TCGTCGGGCACCAGGTGCACGCGCCAACCGCGGTTGTGCAGGGTGACAAG GTCAACGCTGGTGGCTACCTCTCCGCGTAGGCGCTCGTTGGTCCAGCAGA GGCGGCCGCCCTTGCGCGAGCAGAATGGCGGTAGGGGGTCTAGCTGCGTC TCGTCCGGGGGGTCTGCGTCCACGGTAAAGACCCCGGGCAGCAGGCGCGC GTCGAAGTAGTCTATCTTGCATCCTTGCAAGTCTAGCGCCTGCTGCCATG CGCGGGCGGCAAGCGCGCGCTCGTATGGGTTGAGTGGGGGACCCCATGGC ATGGGGTGGGTGAGCGCGGAGGCGTACATGCCGCAAATGTCGTAAACGTA GAGGGGCTCTCTGAGTATTCCAAGATATGTAGGGTAGCATCTTCCACCGC GGATGCTGGCGCGCACGTAATCGTATAGTTCGTGCGAGGGAGCGAGGAGG TCGGGACCGAGGTTGCTACGGGCGGGCTGCTCTGCTCGGAAGACTATCTG CCTGAAGATGGCATGTGAGTTGGATGATATGGTTGGACGCTGGAAGACGT TGAAGCTGGCGTCTGTGAGACCTACCGCGTCACGCACGAAGGAGGCGTAG GAGTCGCGCAGCTTGTTGACCAGCTCGGCGGTGACCTGCACGTCTAGGGC GCAGTAGTCCAGGGTTTCCTTGATGATGTCATACTTATCCTGTCCCTTTT TTTTCCACAGCTCGCGGTTGAGGACAAACTCTTCGCGGTCTTTCCAGTAC TCTTGGATCGGAAACCCGTCGGCCTCCGAACGGTAAGAGCCTAGCATGTA GAACTGGTTGACGGCCTGGTAGGCGCAGCATCCCTTTTCTACGGGTAGCG CGTATGCCTGCGCGGCCTTCCGGAGCGAGGTGTGGGTGAGCGCAAAGGTG TCCCTGACCATGACTTTGAGGTACTGGTATTTGAAGTCAGTGTCGTCGCA TCCGCCCTGCTCCCAGAGCAAAAAGTCCGTGCGCTTTTTGGAACGCGGAT TTGGCAGGGCGAAGGTGACATCGTTGAAGAGTATCTTTCCCGCGCGAGGC ATAAAGTTGCGTGTGATGCGGAAGGGTCCCGGCACCTCGGAACGGTTGTT AATTACCTGGGCGGCGAGCACGATCTCGTCAAAGCCGTTGATGTTGTGGC CCACAATGTAAAGTTCCAAGAAGCGCGGGATGCCCTTGATGGAAGGCAAT TTTTTAAGTTCCTCGTAGGTGAGCTCTTCAGGGGAGCTGAGCCCGTGCTC TGAAAGGGCCCAGTCTGCAAGATGAGGGTTGGAAGCGACGAATGAGCTCC ACAGGTCACGGGCCATTAGCATTTGCAGGTGGTCGCGAAAGGTCCTAAAC TGGCGACCTATGGCCATTTTTTCTGGGGTGATGCAGTAGAAGGTAAGCGG GTCTTGTTCCCAGCGGTCCCATCCAAGGTTCGCGGCTAGGTCTCGCGCGG CAGTCACTAGAGGCTCATCTCCGCCGAACTTCATGACCAGCATGAAGGGC ACGAGCTGCTTCCCAAAGGCCCCCATCCAAGTATAGGTCTCTACATCGTA GGTGACAAAGAGACGCTCGGTGCGAGGATGCGAGCCGATCGGGAAGAACT GGATCTCCCGCCACCAATTGGAGGAGTGGCTATTGATGTGGTGAAAGTAG AAGTCCCTGCGACGGGCCGAACACTCGTGCTGGCTTTTGTAAAAACGTGC GCAGTACTGGCAGCGGTGCACGGGCTGTACATCCTGCACGAGGTTGACCT GACGACCGCGCACAAGGAAGCAGAGTGGGAATTTGAGCCCCTCGCCTGGC GGGTTTGGCTGGTGGTCTTCTACTTCGGCTGCTTGTCCTTGACCGTCTGG CTGCTCGAGGGGAGTTACGGTGGATCGGACCACCACGCCGCGCGAGCCCA AAGTCCAGATGTCCGCGCGCGGCGGTCGGAGCTTGATGACAACATCGCGC AGATGGGAGCTGTCCATGGTCTGGAGCTCCCGCGGCGTCAGGTCAGGCGG GAGCTCCTGCAGGTTTACCTCGCATAGACGGGTCAGGGCGCGGGCTAGAT CCAGGTGATACCTAATTTCCAGGGGCTGGTTGGTGGCGGCGTCGATGGCT TGCAAGAGGCCGCATCCCCGCGGCGCGACTACGGTACCGCGCGGCGGGCG GTGGGCCGCGGGGGTGTCCTTGGATGATGCATCTAAAAGCGGTGACGCGG GCGAGCCCCCGGAGGTAGGGGGGGCTCCGGACCCGCCGGGAGAGGGGGCA GGGGCACGTCGGCGCCGCGCGCGGGCAGGAGCTGGTGCTGCGCGCGTAGG TTGCTGGCGAACGCGACGACGCGGCGGTTGATCTCCTGAATCTGGCGCCT CTGCGTGAAGACGACGGGCCCGGTGAGCTTGAACCTGAAAGAGAGTTCGA CAGAATCAATTTCGGTGTCGTTGACGGCGGCCTGGCGCAAAATCTCCTGC ACGTCTCCTGAGTTGTCTTGATAGGCGATCTCGGCCATGAACTGCTCGAT CTCTTCCTCCTGGAGATCTCCGCGTCCGGCTCGCTCCACGGTGGCGGCGA GGTCGTTGGAAATGCGGGCCATGAGCTGCGAGAAGGCGTTGAGGCCTCCC TCGTTCCAGACGCGGCTGTAGACCACGCCCCCTTCGGCATCGCGGGCGCG CATGACCACCTGCGCGAGATTGAGCTCCACGTGCCGGGCGAAGACGGCGT AGTTTCGCAGGCGCTGAAAGAGGTAGTTGAGGGTGGTGGCGGTGTGTTCT GCCACGAAGAAGTACATAACCCAGCGTCGCAACGTGGATTCGTTGATATC CCCCAAGGCCTCAAGGCGCTCCATGGCCTCGTAGAAGTCCACGGCGAAGT TGAAAAACTGGGAGTTGCGCGCCGACACGGTTAACTCCTCCTCCAGAAGA CGGATGAGCTCGGCGACAGTGTCGCGCACCTCGCGCTCAAAGGCTACAGG GGCCTCTTCTTCTTCTTCAATCTCCTCTTCCATAAGGGCCTCCCCTTCTT CTTCTTCTGGCGGCGGTGGGGGAGGGGGGACACGGCGGCGACGACGGCGC ACCGGGAGGCGGTCGACAAAGCGCTCGATCATCTCCCCGCGGCGACGGCG CATGGTCTCGGTGACGGCGCGGCCGTTCTCGCGGGGGCGCAGTTGGAAGA CGCCGCCCGTCATGTCCCGGTTATGGGTTGGCGGGGGGCTGCCATGCGGC AGGGATACGGCGCTAACGATGCATCTCAACAATTGTTGTGTAGGTACTCC GCCGCCGAGGGACCTGAGCGAGTCCGCATCGACCGGATCGGAAAACCTCT CGAGAAAGGCGTCTAACCAGTCACAGTCGCAAGGTAGGCTGAGCACCGTG GCGGGCGGCAGCGGGCGGCGGTCGGGGTTGTTTCTGGCGGAGGTGCTGCT GATGATGTAATTAAAGTAGGCGGTCTTGAGACGGCGGATGGTCGACAGAA GCACCATGTCCTTGGGTCCGGCCTGCTGAATGCGCAGGCGGTCGGCCATG CCCCAGGCTTCGTTTTGACATCGGCGCAGGTCTTTGTAGTAGTCTTGCAT GAGCCTTTCTACCGGCACTTCTTCTTCTCCTTCCTCTTGTCCTGCATCTC TTGCATCTATCGCTGCGGCGGCGGCGGAGTTTGGCCGTAGGTGGCGCCCT CTTCCTCCCATGCGTGTGACCCCGAAGCCCCTCATCGGCTGAAGCAGGGC TAGGTCGGCGACAACGCGCTCGGCTAATATGGCCTGCTGCACCTGCGTGA GGGTAGACTGGAAGTCATCCATGTCCACAAAGCGGTGGTATGCGCCCGTG TTGATGGTGTAAGTGCAGTTGGCCATAACGGACCAGTTAACGGTCTGGTG ACCCGGCTGCGAGAGCTCGGTGTACCTGAGACGCGAGTAAGCCCTCGAGT CAAATACGTAGTCGTTGCAAGTCCGCACCAGGTACTGGTATCCCACCAAA AAGTGCGGCGGCGGCTGGCGGTAGAGGGGCCAGCGTAGGGTGGCCGGGGC TCCGGGGGCGAGATCTTCCAACATAAGGCGATGATATCCGTAGATGTACC TGGACATCCAGGTGATGCCGGCGGCGGTGGTGGAGGCGCGCGGAAAGTCG CGGACGCGGTTCCAGATGTTGCGCAGCGGCAAAAAGTGCTCCATGGTCGG GACGCTCTGGCCGGTCAGGCGCGCGCAATCGTTGACGCTCTAGACCGTGC AAAAGGAGAGCCTGTAAGCGGGCACTCTTCCGTGGTCTGGTGGATAAATT CGCAAGGGTATCATGGCGGACGACCGGGGTTCGAGCCCCGTATCCGGCCG TCCGCCGTGATCCATGCGGTTACCGCCCGCGTGTCGAACCCAGGTGTGCG ACGTCAGACAACGGGGGAGTGCTCCTTTTGGCTTCCTTCCAGGCGCGGCG GCTGCTGCGCTAGCTTTTTTGGCCACTGGCCGCGCGCAGCGTAAGCGGTT AGGCTGGAAAGCGAAAGCATTAAGTGGCTCGCTCCCTGTAGCCGGAGGGT TATTTTCCAAGGGTTGAGTCGCGGGACCCCCGGTTCGAGTCTCGGACCGG CCGGACTGCGGCGAACGGGGGTTTGCCTCCCCGTCATGCAAGACCCCGCT TGCAAATTCCTCCGGAAACAGGGACGAGCCCCTTTTTTGCTTTTCCCAGA TGCATCCGGTGCTGCGGCAGATGCGCCCCCCTCCTCAGCAGCGGCAAGAG CAAGAGCAGCGGCAGACATGCAGGGCACCCTCCCCTCCTCCTACCGCGTC AGGAGGGGCGACATCCGCGGTTGACGCGGCAGCAGATGGTGATTACGAAC CCCCGCGGCGCCGGGCCCGGCACTACCTGGACTTGGAGGAGGGCGAGGGC CTGGCGCGGCTAGGAGCGCCCTCTCCTGAGCGGCACCCAAGGGTGCAGCT GAAGCGTGATACGCGTGAGGCGTACGTGCCGCGGCAGAACCTGTTTCGCG ACCGCGAGGGAGAGGAGCCCGAGGAGATGCGGGATCGAAAGTTCCACGCA GGGCGCGAGCTGCGGCATGGCCTGAATCGCGAGCGGTTGCTGCGCGAGGA GGACTTTGAGCCCGACGCGCGAACCGGGATTAGTCCCGCGCGCGCACACG TGGCGGCCGCCGACCTGGTAACCGCATACGAGCAGACGGTGAACCAGGAG ATTAACTTTCAAAAAAGCTTTAACAACCACGTGCGTACGCTTGTGGCGCG CGAGGAGGTGGCTATAGGACTGATGCATCTGTGGGACTTTGTAAGCGCGC TGGAGCAAAACCCAAATAGCAAGCCGCTCATGGCGCAGCTGTTCCTTATA GTGCAGCACAGCAGGGACAACGAGGCATTCAGGGATGCGCTGCTAAACAT AGTAGAGCCCGAGGGCCGCTGGCTGCTCGATTTGATAAACATCCTGCAGA GCATAGTGGTGCAGGAGCGCAGCTTGAGCCTGGCTGACAAGGTGGCCGCC ATCAACTATTCCATGCTTAGCCTGGGCAAGTTTTACGCCCGCAAGATATA CCATACCCCTTACGTTCCCATAGACAAGGAGGTAAAGATCGAGGGGTTCT ACATGCGCATGGCGCTGAAGGTGCTTACCTTGAGCGACGACCTGGGCGTT TATCGCAACGAGCGCATCCACAAGGCCGTGAGCGTGAGCCGGCGGCGCGA GCTCAGCGACCGCGAGCTGATGCACAGCCTGCAAAGGGCCCTGGCTGGCA CGGGCAGCGGCGATAGAGAGGCCGAGTCCTACTTTGACGCGGGCGCTGAC CTGCGCTGGGCCCCAAGCCGACGCGCCCTGGAGGCAGCTGGGGCCGGACC TGGGCTGGCGGTGGCACCCGCGCGCGCTGGCAACGTCGGCGGCGTGGAGG AATATGACGAGGACGATGAGTACGAGCCAGAGGACGGCGAGTACTAAGCG GTGATGTTTCTGATCAGATGATGCAAGACGCAACGGACCCGGCGGTGCGG GCGGCGCTGCAGAGCCAGCCGTCCGGCCTTAACTCCACGGACGACTGGCG CCAGGTCATGGACCGCATCATGTCGCTGACTGCGCGCAATCCTGACGCGT TCCGGCAGCAGCCGCAGGCCAACCGGCTCTCCGCAATTCTGGAAGCGGTG GTCCCGGCGCGCGCAAACCCCACGCACGAGAAGGTGCTGGCGATCGTAAA CGCGCTGGCCGAAAACAGGGCCATCCGGCCCGACGAGGCCGGCCTGGTCT ACGACGCGCTGCTTCAGCGCGTGGCTCGTTACAACAGCGGCAACGTGCAG ACCAACCTGGACCGGCTGGTGGGGGATGTGCGCGAGGCCGTGGCGCAGCG TGAGCGCGCGCAGCAGCAGGGCAACCTGGGCTCCATGGTTGCACTAAACG CCTTCCTGAGTACACAGCCCGCCAACGTGCCGCGGGGACAGGAGGACTAC ACCAACTTTGTGAGCGCACTGCGGCTAATGGTGACTGAGACACCGCAAAG TGAGGTGTACCAGTCTGGGCCAGACTATTTTTTCCAGACCAGTAGACAAG GCCTGCAGACCGTAAACCTGAGCCAGGCTTTCAAAAACTTGCAGGGGCTG TGGGGGGTGCGGGCTCCCACAGGCGACCGCGCGACCGTGTCTAGCTTGCT GACGCCCAACTCGCGCCTGTTGCTGCTGCTAATAGCGCCCTTCACGGACA GTGGCAGCGTGTCCCGGGACACATACCTAGGTCACTTGCTGACACTGTAC CGCGAGGCCATAGGTCAGGCGCATGTGGACGAGCATACTTTCCAGGAGAT TACAAGTGTCAGCCGCGCGCTGGGGCAGGAGGACACGGGCAGCCTGGAGG CAACCCTAAACTACCTGCTGACCAACCGGCGGCAGAAGATCCCCTCGTTG CACAGTTTAAACAGCGAGGAGGAGCGCATTTTGCGCTACGTGCAGCAGAG CGTGAGCCTTAACCTGATGCGCGACGGGGTAACGCCCAGCGTGGCGCTGG ACATGACCGCGCGCAACATGGAACCGGGCATGTATGCCTCAAACCGGCCG TTTATCAACCGCCTAATGGACTACTTGCATCGCGCGGCCGCCGTGAACCC CGAGTATTTCACCAATGCCATCTTGAACCCGCACTGGCTACCGCCCCCTG GTTTCTACACCGGGGGATTCGAGGTGCCCGAGGGTAACGATGGATTCCTC TGGGACGACATAGACGACAGCGTGTTTTCCCCGCAACCGCAGACCCTGCT AGAGTTGCAACAGCGCGAGCAGGCAGAGGCGGCGCTGCGAAAGGAAAGCT TCCGCAGGCCAAGCAGCTTGTCCGATCTAGGCGCTGCGGCCCCGCGGTCA GATGCTAGTAGCCCATTTCCAAGCTTGATAGGGTCTCTTACCAGCACTCG CACCACCCGCCCGCGCCTGCTGGGCGAGGAGGAGTACCTAAACAACTCGC TGCTGCAGCCGCAGCGCGAAAAAAACCTGCCTCCGGCATTTCCCAACAAC GGGATAGAGAGCCTAGTGGACAAGATGAGTAGATGGAAGACGTACGCGCA GGAGCACAGGGACGTGCCAGGCCCGCGCCCGCCCACCCGTCGTCAAAGGC ACGACCGTCAGCGGGGTCTGGTGTGGGAGGACGATGACTCGGCAGACGAC AGCAGCGTCCTGGATTTGGGAGGGAGTGGCAACCCGTTTGCGCACCTTCG CCCCAGGCTGGGGAGAATGTTTTAAAAAAAAAAAAAGCATGATGCAAAAT AAAAAACTCACCAAGGCCATGGCACCGAGCGTTGGTTTTCTTGTATTCCC CTTAGTATGCGGCGCGCGGCGATGTATGAGGAAGGTCCTCCTCCCTCCTA CGAGAGTGTGGTGAGCGCGGCGCCAGTGGCGGCGGCGCTGGGTTCTCCCT TCGATGCTCCCCTGGACCCGCCGTTTGTGCCTCCGCGGTACCTGCGGCCT ACCGGGGGGAGAAACAGCATCCGTTACTCTGAGTTGGCACCCCTATTCGA CACCACCCGTGTGTACCTGGTGGACAACAAGTCAACGGATGTGGCATCCC TGAACTACCAGAACGACCACAGCAACTTTCTGACCACGGTCATTCAAAAC AATGACTACAGCCCGGGGGAGGCAAGCACACAGACCATCAATCTTGACGA CCGGTCGCACTGGGGCGGCGACCTGAAAACCATCCTGCATACCAACATGC CAAATGTGAACGAGTTCATGTTTACCAATAAGTTTAAGGCGCGGGTGATG GTGTCGCGCTTGCCTACTAAGGACAATCAGGTGGAGCTGAAATACGAGTG GGTGGAGTTCACGCTGCCCGAGGGCAACTACTCCGAGACCATGACCATAG ACCTTATGAACAACGCGATCGTGGAGCACTACTTGAAAGTGGGCAGACAG AACGGGGTTCTGGAAAGCGACATCGGGGTAAAGTTTGACACCCGCAACTT CAGACTGGGGTTTGACCCCGTCACTGGTCTTGTCATGCCTGGGGTATATA CAAACGAAGCCTTCCATCCAGACATCATTTTGCTGCCAGGATGCGGGGTG GACTTCACCCACAGCCGCCTGAGCAACTTGTTGGGCATCCGCAAGCGGCA ACCCTTCCAGGAGGGCTTTAGGATCACCTACGATGATCTGGAGGGTGGTA ACATTCCCGCACTGTTGGATGTGGACGCCTACCAGGCGAGCTTGAAAGAT GACACCGAACAGGGCGGGGGTGGCGCAGGCGGCAGCAACAGCAGTGGCAG CGGCGCGGAAGAGAACTCCAACGCGGCAGCCGCGGCAATGCAGCCGGTGG AGGACATGAACGATCATGCCATTCGCGGCGACACCTTTGCCACACGGGCT GAGGAGAAGCGCGCTGAGGCCGAAGCAGCGGCCGAAGCTGCCGCCCCCGC TGCGCAACCCGAGGTCGAGAAGCCTCAGAAGAAACCGGTGATCAAACCCC TGACAGAGGACAGCAAGAAACGCAGTTACAACCTAATAAGCAATGACAGC ACCTTCACCCAGTACCGCAGCTGGTACCTTGCATACAACTACGGCGACCC TCAGACCGGAATCCGCTCATGGACCCTGCTTTGCACTCCTGACGTAACCT GCGGCTCGGAGCAGGTCTACTGGTCGTTGCCAGACATGATGCAAGACCCC GTGACCTTCCGCTCCACGCGCCAGATCAGCAACTTTCCGGTGGTGGGCGC CGAGCTGTTGCCCGTGCACTCCAAGAGCTTCTACAACGACCAGGCCGTCT ACTCCCAACTCATCCGCCAGTTTACCTCTCTGACCCACGTGTTCAATCGC TTTCCCGAGAACCAGATTTTGGGCGCGCCGCGACTACGTCCGCGACTGCG TTTACTTATTTCTATGCTACACCTGGCAGACGGCCATGGGCGTTTGGCAG CAGTGCTTGGAGGAGTGCAACCTCAAGGAGCTGCAGAAACTGCTAAAGCA AAACTTGAAGGACCTATGGACGGCCTTCAACGAGCGCTCCGTGGCCGCGC ACCTGGCGGACATCATTTTCCCCGAACGCCTGCTTAAAACCCTGCAACAG GGTCTGCCAGACTTCACCAGTCAAAGCATGTTGCAGAACTTTAGGAACTT TATCCTAGAGCGCTCAGGAATCTTGCCCGCCACCTGCTGTGCACTTCCTA GCGACTTTGTGCCCATTAAGTACCGCGAATGCCCTCCGCCGCTTTGGGGC CACTGCTACCTTCTGCAGCTAGCCAACTACCTTGCCTACCACTCTGACAT AATGGAAGACGTGAGCGGTGACGGTCTACTGGAGTGTCACTGTCGCTGCA ACCTATGCACCCCGCACCGCTCCCTGGTTTGCAATTCGCAGCTGCTTAAC GAAAGTCAAATTATCGGTACCTTTGAGCTGCAGGGTCCCTCGCCTGACGA AAAGTCCGCGGCTCCGGGGTTGAAACTCACTCCGGGGCTGTGGACGTCGG CTTACCTTCGCAAATTTGTACCTGAGGACTACCACGCCCACGAGATTAGG TTCTACGAAGACCAATCCCGCCCGCCTAATGCGGAGCTTACCGCCTGCGT CATTACCCAGGGCCACATTCTTGGCCAATTGCAAGCCATCAACAAAGCCC GCCAAGAGTTTCTGCTACGAAAGGGACGGGGGGTTTACTTGGACCCCCAG TCCGGCGAGGAGCTCAACCCAATCCCCCCGCCGCCGCAGCCCTATCAGCA GCAGCCGCGGGCCCTTGCTTCCCAGGATGGCACCCAAAAAGAAGCTGCAG CTGCCGCCGCCACCCACGGACGAGGAGGAATACTGGGACAGTCAGGCAGA GGAGGTTTTGGACGAGGAGGAGGAGGACATGATGGAAGACTGGGAGAGCC TAGACGAGGAAGCTTCCGAGGTCGAAGAGGTGTCAGACGAAACACCGTCA CCCTCGGTCGCATTCCCCTCGCCGGCGCCCCAGAAATCGGCAACCGGTTC CAGCATGGCTACAACCTCCGCTCCTCAGGCGCCGCCGGCACTGCCCGTTC GCCGACCCAACCGTAGATGGGACACCACTGGAACCAGGGCCGGTAAGTCC AAGCAGCCGCCGCCGTTAGCCCAAGAGCAACAACAGCGCCAAGGCTACCG CTCATGGCGCGGGCACAAGAACGCCATAGTTGCTTGCTTGCAAGACTGTG GGGGCAACATCTCCTTCGCCCGCCGCTTTCTTCTCTACCATCACGGCGTG GCCTTCCCCCGTAACATCCTGCATTACTACCGTCATCTCTACAGCCCATA CTGCACCGGCGGCAGCGGCAGCAACAGCAGCGGCCACACAGAAGCAAAGG CGACCGGATAGCAAGACTCTGACAAAGCCCAAGAAATCCACAGCGGCGGC AGCAGCAGGAGGAGGAGCGCTGCGTCTGGCGCCCAACGAACCCGTATCGA CCCGCGAGCTTAGAAACAGGATTTTTCCCACTCTGTATGCTATATTTCAA CAGAGCAGGGGCCAAGAACAAGAGCTGAAAATAAAAAACAGGTCTCTGCG ATCCCTCACCCGCAGCTGCCTGTATCACAAAAGCGAAGATCAGCTTCGGC GCACGCTGGAAGACGCGGAGGCTCTCTTCAGTAAATACTGCGCGCTGACT CTTAAGGACTAGTTTCGCGCCCTTTCTCAAATTTAAGCGCGAAAACTACG TCATCTCCAGCGGCCACACCCGGCGCCAGCACCTGTTGTCAGCGCCATTA TGAGCAAGGAAATTCCCACGCCCTACATGTGGAGTTACCAGCCACAAATG GGACTTGCGGCTGGAGCTGCCCAAGACTACTCAACCCGAATAAACTACAT GAGCGCGGGACCCCACATGATATCCCGGGTCAACGGAATACGCGCCCACC GAAACCGAATTCTCCTGGAACAGGCGGCTATTACCACCACACCTCGTAAT AACCTTAATCCCCGTAGTTGGCCCGCTGCCCTGGTGTACCAGGAAAGTCC CGCTCCCACCACTGTGGTACTTCCCAGAGACGCCCAGGCCGAAGTTCAGA TGACTAACTCAGGGGCGCAGCTTGCGGGCGGCTTTCGTCACAGGGTGCGG TCGCCCGGGCAGGGTATAACTCACCTGACAATCAGAGGGCGAGGTATTCA GCTCAACGACGAGTCGGTGAGCTCCTCGCTTGGTCTCCGTCCGGACGGGA CATTTCAGATCGGCGGCGCCGGCCGCTCTTCATTCACGCCTCGTCAGGCA ATCCTAACTCTGCAGACCTCGTCCTCTGAGCCGCGCTCTGGAGGCATTGG AACTCTGCAATTTATTGAGGAGTTTGTGCCATCGGTCTACTTTAACCCCT TCTCGGGACCTCCCGGCCACTATCCGGATCAATTTATTCCTAACTTTGAC GCGGTAAAGGACTCGGCGGACGGCTACGACTGAATGTTAAGTGGAGAGGC AGAGCAACTGCGCCTGAAACACCTGGTCCACTGTCGCCGCCACAAGTGCT TTGCCCGCGACTCCGGTGAGTTTTGCTACTTTGAATTGCCCGAGGATCAT ATCGAGGGCCCGGCGCACGGCGTCCGGCTTACCGCCCAGGGAGAGCTTGC CCGTAGCCTGATTCGGGAGTTTACCCAGCGCCCCCTGCTAGTTGAGCGGG ACAGGGGACCCTGTGTTCTCACTGTGATTTGCAACTGTCCTAACCCTGGA TTACATCAAGATCTTTGTTGCCATCTCTGTGCTGAGTATAATAAATACAG AAATTAAAATATACTGGGGCTCCTATCGCCATCCTGTAAACGCCACCGTC TTCACCCGCCCAAGCAAACCAAGGCGAACCTTACCTGGTACTTTTAACAT CTCTCCCTCTGTGATTTACAACAGTTTCAACCCAGACGGAGTGAGTCTAC GAGAGAACCTCTCCGAGCTCAGCTACTCCATCAGAAAAAACACCACCCTC CTTACCTGCCGGGAACGTACGAGTGCGTCACCGGCCGCTGCACCACACCT ACCGCCTGACCGTAAACCAGACTTTTTCCGGACAGACCTCAATAACTCTG TTTACCAGAACAGGAGGTGAGCTTAGAAAACCCTTAGGGTATTAGGCCAA AGGCGCAGCTACTGTGGGGTTTATGAACAATTCAAGCAACTCTACGGGCT ATTCTAATTCAGGTTTCTCTAGAATCGGGGTTGGGGTTATTCTCTGTCTT GTGATTCTCTTTATTCTTATACTAACGCTTCTCTGCCTAAGGCTCGCCGC CTGCTGTGTGCACATTTGCATTTATTGTCAGCTTTTTAAACGCTGGGGTC GCCACCCAAGATGATTAGGTACATAATCCTAGGTTTACTCACCCTTGCGT CAGCCCACGGTACCACCCAAAAGGTGGATTTTAAGGAGCCAGCCTGTAAT GTTACATTCGCAGCTGAAGCTAATGAGTGCACCACTCTTATAAAATGCAC CACAGAACATGAAAAGCTGCTTATTCGCCACAAAAACAAAATTGGCAAGT ATGCTGTTTATGCTATTTGGCAGCCAGGTGACACTACAGAGTATAATGTT ACAGTTTTCCAGGGTAAAAGTCATAAAACTTTTATGTATACTTTTCCATT TTATGAAATGTGCGACATTACCATGTACATGAGCAAACAGTATAAGTTGT GGCCCCCACAAAATTGTGTGGAAAACACTGGCACTTTCTGCTGCACTGCT ATGCTAATTACAGTGCTCGCTTTGGTCTGTACCCTACTCTATATTAAATA CAAAAGCAGACGCAGCTTTATTGAGGAAAAGAAAATGCCTTAATTTACTA AGTTACAAAGCTAATGTCACCACTAACTGCTTTACTCGCTGCTTGCAAAA CAAATTCAAAAAGTTAGCATTATAATTAGAATAGGATTTAAACCCCCCGG TCATTTCCTGCTCAATACCATTCCCCTGAACAATTGACTCTATGTGGGAT ATGCTCCAGCGCTACAACCTTGAAGTCAGGCTTCCTGGATGTCAGCATCT GACTTTGGCCAGCACCTGTCCCGCGGATTTGTTCCAGTCCAACTACAGCG ACCCACCCTAACAGAGATGACCAACACAACCAACGCGGCCGCCGCTACCG GACTTACATCTACCACAAATACACCCCAAGTTTCTGCCTTTGTCAATAAC TGGGATAACTTGGGCATGTGGTGGTTCTCCATAGCGCTTATGTTTGTATG CCTTATTATTATGTGGCTCATCTGCTGCCTAAAGCGCAAACGCGCCCGAC CACCCATCTATAGTCCCATCATTGTGCTACACCCAAACAATGATGGAATC CATAGATTGGACGGACTGAAACACATGTTCTTTTCTCTTACAGTATGATT AAATGAGACATGATTCCTCGAGTTTTTATATTACTGACCCTTGTTGCGCT TTTTTGTGCGTGCTCCACATTGGCTGCGGTTTCTCACATCGAAGTAGACT GCATTCCAGCCTTCACAGTCTATTTGCTTTACGGATTTGTCACCCTCACG CTCATCTGCAGCCTCATCACTGTGGTCATCGCCTTTATCCAGTGCATTGA CTGGGTCTGTGTGCGCTTTGCATATCTCAGACACCATCCCCAGTACAGGG ACAGGACTATAGCTGAGCTTCTTAGAATTCTTTAATTATGAAATTTACTG TGACTTTTCTGCTGATTATTTGCACCCTATCTGCGTTTTGTTCCCCGACC TCCAAGCCTCAAAGACATATATCATGCAGATTCACTCGTATATGGAATAT TCCAAGTTGCTACAATGAAAAAAGCGATCTTTCCGAAGCCTGGTTATATG CAATCATCTCTGTTATGGTGTTCTGCAGTACCATCTTAGCCCTAGCTATA TATCCCTACCTTGACATTGGCTGGAACGCAATAGATGCCATGAACCACCC AACTTTCCCCGCGCCCGCTATGCTTCCACTGCAACAAGTTGTTGCCGGCG GCTTTGTCCCAGCCAATCAGCCTCGCCCACCTTCTCCCACCCCCACTGAA ATCAGCTACTTTAATCTAACAGGAGGAGATGACTGACACCCTAGATCTAG AAATGGACGGAATTATTACAGAGCAGCGCCTGCTAGAAAGACGCAGGGCA GCGGCCGAGCAACAGCGCATGAATCAAGAGCTCCAAGACATGGTTAACTT GCACCAGTGCAAAAGGGGTATCTTTTGTCTCGTAAAGCAGGCCAAAGTCA CCTACGACAGTAATACCACCGGACACCGCCTTAGCTACAAGTTGCCAACC AAGCGTCAGAAATTGGTGGTCATGGTGGGAGAAAAGCCCATTACCATAAC TCAGCACTCGGTAGAAACCGAAGGCTGCATTCACTCACCTTGTCAAGGAC CTGAGGATCTCTGCACCCTTATTAAGACCCTGTGCGGTCTCAAAGATCTT ATTCCCTTTAACTAATAAAAAAAAATAATAAAGCATCACTTACTTAAAAT CAGTTAGCAAATTTCTGTCCAGTTTATTCAGCAGCACCTCCTTGCCCTCC TCCCAGCTCTGGTATTGCAGCTTCCTCCTGGCTGCAAACTTTCTCCACAA TCTAAATGGAATGTCAGTTTCCTCCTGTTCCTGTCCATCCGCACCCACTA TCTTCATGTTGTTGCAGATGAAGCGCGCAAGACCGTCTGAAGATACCTTC AACCCCGTGTATCCATATGACACGGAAACCGGTCCTCCAACTGTGCCTTT TCTTACTCCTCCCTTTGTATCCCCCAATGGGTTTCAAGAGAGTCCCCCTG GGGTACTCTCTTTGCGCCTATCCGAACCTCTAGTTACCTCCAATGGCATG CTTGCGCTCAAAATGGGCAACGGCCTCTCTCTGGACGAGGCCGGCAACCT TACCTCCCAAAATGTAACCACTGTGAGCCCACCTCTCAAAAAAACCAAGT CAAACATAAACCTGGAAATATCTGCACCCCTCACAGTTACCTCAGAAGCC CTAACTGTGGCTGCCGCCGCACCTCTAATGGTCGCGGGCAACACACTCAC CATGCAATCACAGGCCCCGCTAACCGTGCACGACTCCAAACTTAGCATTG CCACCCAAGGACCCCTCACAGTGTCAGAAGGAAAGCTAGCCCTGCAAACA TCAGGCCCCCTCACCACCACCGATAGCAGTACCCTTACTATCACTGCCTC ACCCCCTCTAACTACTGCCACTGGTAGCTTGGGCATTGACTTGAAAGAGC CCATTTATACACAAAATGGAAAACTAGGACTAAAGTACGGGGCTCCTTTG CATGTAACAGACGACCTAAACACTTTGACCGTAGCAACTGGTCCAGGTGT GACTATTAATAATACTTCCTTGCAAACTAAAGTTACTGGAGCCTTGGGTT TTGATTCACAAGGCAATATGCAACTTAATGTAGCAGGAGGACTAAGGATT GATTCTCAAAACAGACGCCTTATACTTGATGTTAGTTATCCGTTTGATGC TCAAAACCAACTAAATCTAAGACTAGGACAGGGCCCTCTTTTTATAAACT CAGCCCACAACTTGGATATTAACTACAACAAAGGCCTTTACTTGTTTACA GCTTCAAACAATTCCAAAAAGCTTGAGGTTAACCTAAGCACTGCCAAGGG GTTGATGTTTGACGCTACAGCCATAGCCATTAATGCAGGAGATGGGCTTG AATTTGGTTCACCTAATGCACCAAACACAAATCCCCTCAAAACAAAAATT GGCCATGGCCTAGAATTTGATTCAAACAAGGCTATGGTTCCTAAACTAGG AACTGGCCTTAGTTTTGACAGCACAGGTGCCATTACAGTAGGAAACAAAA ATAATGATAAGCTAACTTTGTGGACCACACCAGCTCCATCTCCTAACTGT AGACTAAATGCAGAGAAAGATGCTAAACTCACTTTGGTCTTAACAAAATG TGGCAGTCAAATACTTGCTACAGTTTCAGTTTTGGCTGTTAAAGGCAGTT TGGCTCCAATATCTGGAACAGTTCAAAGTGCTCATCTTATTATAAGATTT GACGAAAATGGAGTGCTACTAAACAATTCCTTCCTGGACCCAGAATATTG GAACTTTAGAAATGGAGATCTTACTGAAGGCACAGCCTATACAAACGCTG TTGGATTTATGCCTAACCTATCAGCTTATCCAAAATCTCACGGTAAAACT GCCAAAAGTAACATTGTCAGTCAAGTTTACTTAAACGGAGACAAAACTAA ACCTGTAACACTAACCATTACACTAAACGGTACACAGGAAACAGGAGACA CAACTCCAAGTGCATACTCTATGTCATTTTCATGGGACTGGTCTGGCCAC AACTACATTAATGAAATATTTGCCACATCCTCTTACACTTTTTCATACAT TGCCCAAGAATAAAGAATCGTTTGTGTTATGTTTCAACGTGTTTATTTTT CAATTGCAGAAAATTTCAAGTCATTTTTCATTCAGTAGTATAGCCCCACC ACCACATAGCTTATACAGATCACCGTACCTTAATCAAACTCACAGAACCC TAGTATTCAACCTGCCACCTCCCTCCCAACACACAGAGTACACAGTCCTT TCTCCCCGGCTGGCCTTAAAAAGCATCATATCATGGGTAACAGACATATT CTTAGGTGTTATATTCCACACGGTTTCCTGTCGAGCCAAACGCTCATCAG TGATATTAATAAACTCCCCGGGCAGCTCACTTAAGTTCATGTCGCTGTCC AGCTGCTGAGCCACAGGCTGCTGTCCAACTTGCGGTTGCTTAACGGGCGG CGAAGGAGAAGTCCACGCCTACATGGGGGTAGAGTCATAATCGTGCATCA GGATAGGGCGGTGGTGCTGCAGCAGCGCGCGAATAAACTGCTGCCGCCGC CGCTCCGTCCTGCAGGAATACAACATGGCAGTGGTCTCCTCAGCGATGAT TCGCACCGCCCGCAGCATAAGGCGCCTTGTCCTCCGGGCACAGCAGCGCA CCCTGATCTCACTTAAATCAGCACAGTAACTGCAGCACAGCACCACAATA TTGTTCAAAATCCCACAGTGCAAGGCGCTGTATCCAAAGCTCATGGCGGG GACCACAGAACCCACGTGGCCATCATACCACAAGCGCAGGTAGATTAAGT GGCGACCCCTCATAAACACGCTGGACATAAACATTACCTCTTTTGGCATG TTGTAATTCACCACCTCCCGGTACCATATAAACCTCTGATTAAACATGGC GCCATCCACCACCATCCTAAACCAGCTGGCCAAAACCTGCCCGCCGGCTA TACACTGCAGGGAACCGGGACTGGAACAATGACAGTGGAGAGCCCAGGAC TCGTAACCATGGATCATCATGCTCGTCATGATATCAATGTTGGCACAACA CAGGCACACGTGCATACACTTCCTCAGGATTACAAGCTCCTCCCGCGTTA GAACCATATCCCAGGGAACAACCCATTCCTGAATCAGCGTAAATCCCACA CTGCAGGGAAGACCTCGCACGTAACTCACGTTGTGCATTGTCAAAGTGTT ACATTCGGGCAGCAGCGGATGATCCTCCAGTATGGTAGCGCGGGTTTCTG TCTCAAAAGGAGGTAGACGATCCCTACTGTACGGAGTGCGCCGAGACAAC CGAGATCGTGTTGGTCGTAGTGTCATGCCAAATGGAACGCCGGACGTAGT CATATTTCCTGAAGCAAAACCAGGTGCGGGCGTGACAAACAGATCTGCGT CTCCGGTCTCGCCGCTTAGATCGCTCTGTGTAGTAGTTGTAGTATATCCA CTCTCTCAAAGCATCCAGGCGCCCCCTGGCTTCGGGTTCTATGTAAACTC CTTCATGCGCCGCTGCCCTGATAACATCCACCACCGCAGAATAAGCCACA CCCAGCCAACCTACACATTCGTTCTGCGAGTCACACACGGGAGGAGCGGG AAGAGCTGGAAGAACCATGTTTTTTTTTTTATTCCAAAAGATTATCCAAA ACCTCAAAATGAAGATCTATTAAGTGAACGCGCTCCCCTCCGGTGGCGTG GTCAAACTCTACAGCCAAAGAACAGATAATGGCATTTGTAAGATGTTGCA CAATGGCTTCCAAAAGGCAAACGGCCCTCACGTCCAAGTGGACGTAAAGG CTAAACCCTTCAGGGTGAATCTCCTCTATAAACATTCCAGCACCTTCAAC CATGCCCAAATAATTCTCATCTCGCCACCTTCTCAATATATCTCTAAGCA AATCCCGAATATTAAGTCCGGCCATTGTAAAAATCTGCTCCAGAGCGCCC TCCACCTTCAGCCTCAAGCAGCGAATCATGATTGCAAAAATTCAGGTTCC TCACAGACCTGTATAAGATTCAAAAGCGGAACATTAACAAAAATACCGCG ATCCCGTAGGTCCCTTCGCAGGGCCAGCTGAACATAATCGTGCAGGTCTG CACGGACCAGCGCGGCCACTTCCCCGCCAGGAACCATGACAAAAGAACCC ACACTGATTATGACACGCATACTCGGAGCTATGCTAACCAGCGTAGCCCC GATGTAAGCTTGTTGCATGGGCGGCGATATAAAATGCAAGGTGCTGCTCA AAAAATCAGGCAAAGCCTCGCGCAAAAAAGAAAGCACATCGTAGTCATGC TCATGCAGATAAAGGCAGGTAAGCTCCGGAACCACCACAGAAAAAGACAC CATTTTTCTCTCAAACATGTCTGCGGGTTTCTGCATAAACACAAAATAAA ATAACAAAAAAACATTTAAACATTAGAAGCCTGTCTTACAACAGGAAAAA CAACCCTTATAAGCATAAGACGGACTACGGCCATGCCGGCGTGACCGTAA AAAAACTGGTCACCGTGATTAAAAAGCACCACCGACAGCTCCTCGGTCAT GTCCGGAGTCATAATGTAAGACTCGGTAAACACATCAGGTTGATTCACAT CGGTCAGTGCTAAAAAGCGACCGAAATAGCCCGGGGGAATACATACCCGC AGGCGTAGAGACAACATTACAGCCCCCATAGGAGGTATAACAAAATTAAT AGGAGAGAAAAACACATAAACACCTGAAAAACCCTCCTGCCTAGGCAAAA TAGCACCCTCCCGCTCCAGAACAACATACAGCGCTTCCACAGCGGCAGCC ATAACAGTCAGCCTTACCAGTAAAAAAGAAAACCTATTAAAAAAACACCA CTCGACACGGCACCAGCTCAATCAGTCACAGTGTAAAAAAGGGCCAAGTG CAGAGCGAGTATATATAGGACTAAAAAATGACGTAACGGTTAAAGTCCAC AAAAAACACCCAGAAAACCGCACGCGAACCTACGCCCAGAAACGAAAGCC AAAAAACCCACAACTTCCTCAAATCGTCACTTCCGTTTTCCCACGTTACG TCACTTCCCATTTTAAGAAAACTACAATTCCCAACACATACAAGTTACTC CGCCCTAAAACCTACGTCACCCGCCCCGTTCCCACGCCCCGCGCCACGTC ACAAACTCCACCCCCTCATTATCATATTGGCTTCAATCCAAAATAAGGTA TATTATTGATGATGTTAATTAAGAATTCGGATCTGCGACGCGAGGCTGGA TGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATGCCC GCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACA GCTTCAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGG CGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTT TCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTA CCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAT AGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCT GGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCG GTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTG GCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGC TACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAG TATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTT GGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTT TGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATC CTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGT TAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCT TTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCA ATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCAT CCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGC TTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACC GGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCA GAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGC CGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGT TGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTT CATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATG TTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAG TAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATT CTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTAC TCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTG CCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAG TGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTA CCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATC TTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAA GGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATA CTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTG TCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAG GGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACC ATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTT TCGTCTTCAAGAATTGGATCCGAATTCTTAATTAA

Personal tools