PCP08

From OpenWetWare

Revision as of 11:29, 30 August 2006 by Crp724 (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

comments:pCP03 with lacZ inserted in hexon at NdeI site (19548nt)

sequence:

CATCATCAATAATATACCTTATTTTGGATTGAAGCCAATATGATAATGAG GGGGTGGAGTTTGTGACGTGGCGCGGGGCGTGGGAACGGGGCGGGTGACG TAGTAGTGTGGCGGAAGTGTGATGTTGCAAGTGTGGCGGAACACATGTAA GCGACGGATGTGGCAAAAGTGACGTTTTTGGTGTGCGCCGGTGTACACAG GAAGTGACAATTTTCGCGCGGTTTTAGGCGGATGTTGTAGTAAATTTGGG CGTAACCGAGTAAGATTTGGCCATTTTCGCGGGAAAACTGAATAAGAGGA AGTGAAATCTGAATAATTTTGTGTTACTCATAGCGCGTAATATTTGTCTA GGGCCGCGGGGACTTTGACCGTTTACGTGGAGACTCGCCCAGGTGTTTTT CTCAGGTGTTTTCCGCGTTCCGGGTCAAAGTTGGCGTTTTATTATTATAG TCAGCTGACGTGTAGTGTATTTATACCCGGTGAGTTCCTCAAGAGGCCAC TCTTGAGTGCCAGCGAGTAGAGTTTTCTCCTCCGAGCCGCTCCGACACCG GGACTGAAAATGAGACATATTATCTGCCACGGAGGTGTTATTACCGAAGA AATGGCCGCCAGTCTTTTGGACCAGCTGATCGAAGAGGTACTGGCTGATA ATCTTCCACCTCCTAGCCATTTTGAACCACCTACCCTTCACGAACTGTAT GATTTAGACGTGACGGCCCCCGAAGATCCCAACGAGGAGGCGGTTTCGCA GATTTTTCCCGACTCTGTAATGTTGGCGGTGCAGGAAGGGATTGACTTAC TCACTTTTCCGCCGGCGCCCGGTTCTCCGGAGCCGCCTCACCTTTCCCGG CAGCCCGAGCAGCCGGAGCAGAGAGCCTTGGGTCCGGTTTCTATGCCAAA CCTTGTACCGGAGGTGATCGATCTTACCTGCCACGAGGCTGGCTTTCCAC CCAGTGACGACGAGGATGAAGAGGGTGAGGAGTTTGTGTTAGATTATGTG GAGCACCCCGGGCACGGTTGCAGGTCTTGTCATTATCACCGGAGGAATAC GGGGGACCCAGATATTATGTGTTCGCTTTGCTATATGAGGACCTGTGGCA TGTTTGTCTACAGTAAGTGAAAATTATGGGCAGTGGGTGATAGAGTGGTG GGTTTGGTGTGGTAATTTTTTTTTTAATTTTTACAGTTTTGTGGTTTAAA GAATTTTGTATTGTGATTTTTTTAAAAGGTCCTGTGTCTGAACCTGAGCC TGAGCCCGAGCCAGAACCGGAGCCTGCAAGACCTACCCGCCGTCCTAAAA TGGCGCCTGCTATCCTGAGACGCCCGACATCACCTGTGTCTAGAGAATGC AATAGTAGTACGGATAGCTGTGACTCCGGTCCTTCTAACACACCTCCTGA GATACACCCGGTGGTCCCGCTGTGCCCCATTAAACCAGTTGCCGTGAGAG TTGGTGGGCGTCGCCAGGCTGTGGAATGTATCGAGGACTTGCTTAACGAG CCTGGGCAACCTTTGGACTTGAGCTGTAAACGCCCCAGGCCATAAGGTGT AAACCTGTGATTGCGTGTGTGGTTAACGCCTTTGTTTGCTGAATGAGTTG ATGTAAGTTTAATAAAGGGTGAGATAATGTTTAACTTGCATGGCGTGTTA AATGGGGCGGGGCTTAAAGGGTATATAATGCGCCGTGGGCTAATCTTGGT TACATCTGACCTCATGGAGGCTTGGGAGTGTTTGGAAGATTTTTCTGCTG TGCGTAACTTGCTGGAACAGAGCTCTAACAGTACCTCTTGGTTTTGGAGG TTTCTGTGGGGCTCATCCCAGGCAAAGTTAGTCTGCAGAATTAAGGAGGA TTACAAGTGGGAATTTGAAGAGCTTTTGAAATCCTGTGGTGAGCTGTTTG ATTCTTTGAATCTGGGTCACCAGGCGCTTTTCCAAGAGAAGGTCATCAAG ACTTTGGATTTTTCCACACCGGGGCGCGCTGCGGCTGCTGTTGCTTTTTT GAGTTTTATAAAGGATAAATGGAGCGAAGAAACCCATCTGAGCGGGGGGT ACCTGCTGGATTTTCTGGCCATGCATCTGTGGAGAGCGGTTGTGAGACAC AAGAATCGCCTGCTACTGTTGTCTTCCGTCCGCCCGGCGATAATACCGAC GGAGGAGCAGCAGCAGCAGCAGGAGGAAGCCAGGCGGCGGCGGCAGGAGC AGAGCCCATGGAACCCGAGAGCCGGCCTGGACCCTCGGGAATGAATGTTG TACAGGTGGCTGAACTGTATCCAGAACTGAGACGCATTTTGACAATTACA GAGGATGGGCAGGGGCTAAAGGGGGTAAAGAGGGAGCGGGGGGCTTGTGA GGCTACAGAGGAGGCTAGGAATCTAGCTTTTAGCTTAATGACCAGACACC GTCCTGAGTGTATTACTTTTCAACAGATCAAGGATAATTGCGCTAATGAG CTTGATCTGCTGGCGCAGAAGTATTCCATAGAGCAGCTGACCACTTACTG GCTGCAGCCAGGGGATGATTTTGAGGAGGCTATTAGGGTATATGCAAAGG TGGCACTTAGGCCAGATTGCAAGTACAAGATCAGCAAACTTGTAAATATC AGGAATTGTTGCTACATTTCTGGGAACGGGGCCGAGGTGGAGATAGATAC GGAGGATAGGGTGGCCTTTAGATGTAGCATGATAAATATGTGGCCGGGGG TGCTTGGCATGGACGGGGTGGTTATTATGAATGTAAGGTTTACTGGCCCC AATTTTAGCGGTACGGTTTTCCTGGCCAATACCAACCTTATCCTACACGG TGTAAGCTTCTATGGGTTTAACAATACCTGTGTGGAAGCCTGGACCGATG TAAGGGTTCGGGGCTGTGCCTTTTACTGCTGCTGGAAGGGGGTGGTGTGT CGCCCCAAAAGCAGGGCTTCAATTAAGAAATGCCTCTTTGAAAGGTGTAC CTTGGGTATCCTGTCTGAGGGTAACTCCAGGGTGCGCCACAATGTGGCCT CCGACTGTGGTTGCTTCATGCTAGTGAAAAGCGTGGCTGTGATTAAGCAT AACATGGTATGTGGCAACTGCGAGGACAGGGCCTCTCAGATGCTGACCTG CTCGGACGGCAACTGTCACCTGCTGAAGACCATTCACGTAGCCAGCCACT CTCGCAAGGCCTGGCCAGTGTTTGAGCATAACATACTGACCCGCTGTTCC TTGCATTTGGGTAACAGGAGGGGGGTGTTCCTACCTTACCAATGCAATTT GAGTCACACTAAGATATTGCTTGAGCCCGAGAGCATGTCCAAGGTGAACC TGAACGGGGTGTTTGACATGACCATGAAGATCTGGAAGGTGCTGAGGTAC GATGAGACCCGCACCAGGTGCAGACCCTGCGAGTGTGGCGGTAAACATAT TAGGAACCAGCCTGTGATGCTGGATGTGACCGAGGAGCTGAGGCCCGATC ACTTGGTGCTGGCCTGCACCCGCGCTGAGTTTGGCTCTAGCGATGAAGAT ACAGATTGAGGTACTGAAATGTGTGGGCGTGGCTTAAGGGTGGGAAAGAA TATATAAGGTGGGGGTCTTATGTAGTTTTGTATCTGTTTTGCAGCAGCCG CCGCCGCCATGAGCACCAACTCGTTTGATGGAAGCATTGTGAGCTCATAT TTGACAACGCGCATGCCCCCATGGGCCGGGGTGCGTCAGAATGTGATGGG CTCCAGCATTGATGGTCGCCCCGTCCTGCCCGCAAACTCTACTACCTTGA CCTACGAGACCGTGTCTGGAACGCCGTTGGAGACTGCAGCCTCCGCCGCC GCTTCAGCCGCTGCAGCCACCGCCCGCGGGATTGTGACTGACTTTGCTTT CCTGAGCCCGCTTGCAAGCAGTGCAGCTTCCCGTTCATCCGCCCGCGATG ACAAGTTGACGGCTCTTTTGGCACAATTGGATTCTTTGACCCGGGAACTT AATGTCGTTTCTCAGCAGCTGTTGGATCTGCGCCAGCAGGTTTCTGCCCT GAAGGCTTCCTCCCCTCCCAATGCGGTTTAAAACATAAATAAAAAACCAG ACTCTGTTTGGATTTGGATCAAGCAAGTGTCTTGCTGTCTTTATTTAGGG GTTTTGCGCGCGCGGTAGGCCCGGGACCAGCGGTCTCGGTCGTTGAGGGT CCTGTGTATTTTTTCCAGGACGTGGTAAAGGTGACTCTGGATGTTCAGAT ACATGGGCATAAGCCCGTCTCTGGGGTGGAGGTAGCACCACTGCAGAGCT TCATGCTGCGGGGTGGTGTTGTAGATGATCCAGTCGTAGCAGGAGCGCTG GGCGTGGTGCCTAAAAATGTCTTTCAGTAGCAAGCTGATTGCCAGGGGCA GGCCCTTGGTGTAAGTGTTTACAAAGCGGTTAAGCTGGGATGGGTGCATA CGTGGGGATATGAGATGCATCTTGGACTGTATTTTTAGGTTGGCTATGTT CCCAGCCATATCCCTCCGGGGATTCATGTTGTGCAGAACCACCAGCACAG TGTATCCGGTGCACTTGGGAAATTTGTCATGTAGCTTAGAAGGAAATGCG TGGAAGAACTTGGAGACGCCCTTGTGACCTCCAAGATTTTCCATGCATTC GTCCATAATGATGGCAATGGGCCCACGGGCGGCGGCCTGGGCGAAGATAT TTCTGGGATCACTAACGTCATAGTTGTGTTCCAGGATGAGATCGTCATAG GCCATTTTTACAAAGCGCGGGCGGAGGGTGCCAGACTGCGGTATAATGGT TCCATCCGGCCCAGGGGCGTAGTTACCCTCACAGATTTGCATTTCCCACG CTTTGAGTTCAGATGGGGGGATCATGTCTACCTGCGGGGCGATGAAGAAA ACGGTTTCCGGGGTAGGGGAGATCAGCTGGGAAGAAAGCAGGTTCCTGAG CAGCTGCGACTTACCGCAGCCGGTGGGCCCGTAAATCACACCTATTACCG GCTGCAACTGGTAGTTAAGAGAGCTGCAGCTGCCGTCATCCCTGAGCAGG GGGGCCACTTCGTTAAGCATGTCCCTGACTCGCATGTTTTCCCTGACCAA ATCCGCCAGAAGGCGCTCGCCGCCCAGCGATAGCAGTTCTTGCAAGGAAG CAAAGTTTTTCAACGGTTTGAGACCGTCCGCCGTAGGCATGCTTTTGAGC GTTTGACCAAGCAGTTCCAGGCGGTCCCACAGCTCGGTCACCTGCTCTAC GGCATCTCGATCCAGCATATCTCCTCGTTTCGCGGGTTGGGGCGGCTTTC GCTGTACGGCAGTAGTCGGTGCTCGTCCAGACGGGCCAGGGTCATGTCTT TCCACGGGCGCAGGGTCCTCGTCAGCGTAGTCTGGGTCACGGTGAAGGGG TGCGCTCCGGGCTGCGCGCTGGCCAGGGTGCGCTTGAGGCTGGTCCTGCT GGTGCTGAAGCGCTGCCGGTCTTCGCCCTGCGCGTCGGCCAGGTAGCATT TGACCATGGTGTCATAGTCCAGCCCCTCCGCGGCGTGGCCCTTGGCGCGC AGCTTGCCCTTGGAGGAGGCGCCGCACGAGGGGCAGTGCAGACTTTTGAG GGCGTAGAGCTTGGGCGCGAGAAATACCGATTCCGGGGAGTAGGCATCCG CGCCGCAGGCCCCGCAGACGGTCTCGCATTCCACGAGCCAGGTGAGCTCT GGCCGTTCGGGGTCAAAAACCAGGTTTCCCCCATGCTTTTTGATGCGTTT CTTACCTCTGGTTTCCATGAGCCGGTGTCCACGCTCGGTGACGAAAAGGC TGTCCGTGTCCCCGTATACAGACTTGAGAGGCCTGTCCTCGAGCGGTGTT CCGCGGTCCTCCTCGTATAGAAACTCGGACCACTCTGAGACAAAGGCTCG CGTCCAGGCCAGCACGAAGGAGGCTAAGTGGGAGGGGTAGCGGTCGTTGT CCACTAGGGGGTCCACTCGCTCCAGGGTGTGAAGACACATGTCGCCCTCT TCGGCATCAAGGAAGGTGATTGGTTTGTAGGTGTAGGCCACGTGACCGGG TGTTCCTGAAGGGGGGCTATAAAAGGGGGTGGGGGCGCGTTCGTCCTCAC TCTCTTCCGCATCGCTGTCTGCGAGGGCCAGCTGTTGGGGTGAGTACTCC CTCTGAAAAGCGGGCATGACTTCTGCGCTAAGATTGTCAGTTTCCAAAAA CGAGGAGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGG CCGCATCCATCTGGTCAGAAAAGACAATCTTTTTGTTGTCAAGCTTGGTG GCAAACGACCCGTAGAGGGCGTTGGACAGCAACTTGGCGATGGAGCGCAG GGTTTGGTTTTTGTCGCGATCGGCGCGCTCCTTGGCCGCGATGTTTAGCT GCACGTATTCGCGCGCAACGCACCGCCATTCGGGAAAGACGGTGGTGCGC TCGTCGGGCACCAGGTGCACGCGCCAACCGCGGTTGTGCAGGGTGACAAG GTCAACGCTGGTGGCTACCTCTCCGCGTAGGCGCTCGTTGGTCCAGCAGA GGCGGCCGCCCTTGCGCGAGCAGAATGGCGGTAGGGGGTCTAGCTGCGTC TCGTCCGGGGGGTCTGCGTCCACGGTAAAGACCCCGGGCAGCAGGCGCGC GTCGAAGTAGTCTATCTTGCATCCTTGCAAGTCTAGCGCCTGCTGCCATG CGCGGGCGGCAAGCGCGCGCTCGTATGGGTTGAGTGGGGGACCCCATGGC ATGGGGTGGGTGAGCGCGGAGGCGTACATGCCGCAAATGTCGTAAACGTA GAGGGGCTCTCTGAGTATTCCAAGATATGTAGGGTAGCATCTTCCACCGC GGATGCTGGCGCGCACGTAATCGTATAGTTCGTGCGAGGGAGCGAGGAGG TCGGGACCGAGGTTGCTACGGGCGGGCTGCTCTGCTCGGAAGACTATCTG CCTGAAGATGGCATGTGAGTTGGATGATATGGTTGGACGCTGGAAGACGT TGAAGCTGGCGTCTGTGAGACCTACCGCGTCACGCACGAAGGAGGCGTAG GAGTCGCGCAGCTTGTTGACCAGCTCGGCGGTGACCTGCACGTCTAGGGC GCAGTAGTCCAGGGTTTCCTTGATGATGTCATACTTATCCTGTCCCTTTT TTTTCCACAGCTCGCGGTTGAGGACAAACTCTTCGCGGTCTTTCCAGTAC TCTTGGATCGGAAACCCGTCGGCCTCCGAACGGTAAGAGCCTAGCATGTA GAACTGGTTGACGGCCTGGTAGGCGCAGCATCCCTTTTCTACGGGTAGCG CGTATGCCTGCGCGGCCTTCCGGAGCGAGGTGTGGGTGAGCGCAAAGGTG TCCCTGACCATGACTTTGAGGTACTGGTATTTGAAGTCAGTGTCGTCGCA TCCGCCCTGCTCCCAGAGCAAAAAGTCCGTGCGCTTTTTGGAACGCGGAT TTGGCAGGGCGAAGGTGACATCGTTGAAGAGTATCTTTCCCGCGCGAGGC ATAAAGTTGCGTGTGATGCGGAAGGGTCCCGGCACCTCGGAACGGTTGTT AATTACCTGGGCGGCGAGCACGATCTCGTCAAAGCCGTTGATGTTGTGGC CCACAATGTAAAGTTCCAAGAAGCGCGGGATGCCCTTGATGGAAGGCAAT TTTTTAAGTTCCTCGTAGGTGAGCTCTTCAGGGGAGCTGAGCCCGTGCTC TGAAAGGGCCCAGTCTGCAAGATGAGGGTTGGAAGCGACGAATGAGCTCC ACAGGTCACGGGCCATTAGCATTTGCAGGTGGTCGCGAAAGGTCCTAAAC TGGCGACCTATGGCCATTTTTTCTGGGGTGATGCAGTAGAAGGTAAGCGG GTCTTGTTCCCAGCGGTCCCATCCAAGGTTCGCGGCTAGGTCTCGCGCGG CAGTCACTAGAGGCTCATCTCCGCCGAACTTCATGACCAGCATGAAGGGC ACGAGCTGCTTCCCAAAGGCCCCCATCCAAGTATAGGTCTCTACATCGTA GGTGACAAAGAGACGCTCGGTGCGAGGATGCGAGCCGATCGGGAAGAACT GGATCTCCCGCCACCAATTGGAGGAGTGGCTATTGATGTGGTGAAAGTAG AAGTCCCTGCGACGGGCCGAACACTCGTGCTGGCTTTTGTAAAAACGTGC GCAGTACTGGCAGCGGTGCACGGGCTGTACATCCTGCACGAGGTTGACCT GACGACCGCGCACAAGGAAGCAGAGTGGGAATTTGAGCCCCTCGCCTGGC GGGTTTGGCTGGTGGTCTTCTACTTCGGCTGCTTGTCCTTGACCGTCTGG CTGCTCGAGGGGAGTTACGGTGGATCGGACCACCACGCCGCGCGAGCCCA AAGTCCAGATGTCCGCGCGCGGCGGTCGGAGCTTGATGACAACATCGCGC AGATGGGAGCTGTCCATGGTCTGGAGCTCCCGCGGCGTCAGGTCAGGCGG GAGCTCCTGCAGGTTTACCTCGCATAGACGGGTCAGGGCGCGGGCTAGAT CCAGGTGATACCTAATTTCCAGGGGCTGGTTGGTGGCGGCGTCGATGGCT TGCAAGAGGCCGCATCCCCGCGGCGCGACTACGGTACCGCGCGGCGGGCG GTGGGCCGCGGGGGTGTCCTTGGATGATGCATCTAAAAGCGGTGACGCGG GCGAGCCCCCGGAGGTAGGGGGGGCTCCGGACCCGCCGGGAGAGGGGGCA GGGGCACGTCGGCGCCGCGCGCGGGCAGGAGCTGGTGCTGCGCGCGTAGG TTGCTGGCGAACGCGACGACGCGGCGGTTGATCTCCTGAATCTGGCGCCT CTGCGTGAAGACGACGGGCCCGGTGAGCTTGAACCTGAAAGAGAGTTCGA CAGAATCAATTTCGGTGTCGTTGACGGCGGCCTGGCGCAAAATCTCCTGC ACGTCTCCTGAGTTGTCTTGATAGGCGATCTCGGCCATGAACTGCTCGAT CTCTTCCTCCTGGAGATCTCCGCGTCCGGCTCGCTCCACGGTGGCGGCGA GGTCGTTGGAAATGCGGGCCATGAGCTGCGAGAAGGCGTTGAGGCCTCCC TCGTTCCAGACGCGGCTGTAGACCACGCCCCCTTCGGCATCGCGGGCGCG CATGACCACCTGCGCGAGATTGAGCTCCACGTGCCGGGCGAAGACGGCGT AGTTTCGCAGGCGCTGAAAGAGGTAGTTGAGGGTGGTGGCGGTGTGTTCT GCCACGAAGAAGTACATAACCCAGCGTCGCAACGTGGATTCGTTGATATC CCCCAAGGCCTCAAGGCGCTCCATGGCCTCGTAGAAGTCCACGGCGAAGT TGAAAAACTGGGAGTTGCGCGCCGACACGGTTAACTCCTCCTCCAGAAGA CGGATGAGCTCGGCGACAGTGTCGCGCACCTCGCGCTCAAAGGCTACAGG GGCCTCTTCTTCTTCTTCAATCTCCTCTTCCATAAGGGCCTCCCCTTCTT CTTCTTCTGGCGGCGGTGGGGGAGGGGGGACACGGCGGCGACGACGGCGC ACCGGGAGGCGGTCGACAAAGCGCTCGATCATCTCCCCGCGGCGACGGCG CATGGTCTCGGTGACGGCGCGGCCGTTCTCGCGGGGGCGCAGTTGGAAGA CGCCGCCCGTCATGTCCCGGTTATGGGTTGGCGGGGGGCTGCCATGCGGC AGGGATACGGCGCTAACGATGCATCTCAACAATTGTTGTGTAGGTACTCC GCCGCCGAGGGACCTGAGCGAGTCCGCATCGACCGGATCGGAAAACCTCT CGAGAAAGGCGTCTAACCAGTCACAGTCGCAAGGTAGGCTGAGCACCGTG GCGGGCGGCAGCGGGCGGCGGTCGGGGTTGTTTCTGGCGGAGGTGCTGCT GATGATGTAATTAAAGTAGGCGGTCTTGAGACGGCGGATGGTCGACAGAA GCACCATGTCCTTGGGTCCGGCCTGCTGAATGCGCAGGCGGTCGGCCATG CCCCAGGCTTCGTTTTGACATCGGCGCAGGTCTTTGTAGTAGTCTTGCAT GAGCCTTTCTACCGGCACTTCTTCTTCTCCTTCCTCTTGTCCTGCATCTC TTGCATCTATCGCTGCGGCGGCGGCGGAGTTTGGCCGTAGGTGGCGCCCT CTTCCTCCCATGCGTGTGACCCCGAAGCCCCTCATCGGCTGAAGCAGGGC TAGGTCGGCGACAACGCGCTCGGCTAATATGGCCTGCTGCACCTGCGTGA GGGTAGACTGGAAGTCATCCATGTCCACAAAGCGGTGGTATGCGCCCGTG TTGATGGTGTAAGTGCAGTTGGCCATAACGGACCAGTTAACGGTCTGGTG ACCCGGCTGCGAGAGCTCGGTGTACCTGAGACGCGAGTAAGCCCTCGAGT CAAATACGTAGTCGTTGCAAGTCCGCACCAGGTACTGGTATCCCACCAAA AAGTGCGGCGGCGGCTGGCGGTAGAGGGGCCAGCGTAGGGTGGCCGGGGC TCCGGGGGCGAGATCTTCCAACATAAGGCGATGATATCCGTAGATGTACC TGGACATCCAGGTGATGCCGGCGGCGGTGGTGGAGGCGCGCGGAAAGTCG CGGACGCGGTTCCAGATGTTGCGCAGCGGCAAAAAGTGCTCCATGGTCGG GACGCTCTGGCCGGTCAGGCGCGCGCAATCGTTGACGCTCTAGACCGTGC AAAAGGAGAGCCTGTAAGCGGGCACTCTTCCGTGGTCTGGTGGATAAATT CGCAAGGGTATCATGGCGGACGACCGGGGTTCGAGCCCCGTATCCGGCCG TCCGCCGTGATCCATGCGGTTACCGCCCGCGTGTCGAACCCAGGTGTGCG ACGTCAGACAACGGGGGAGTGCTCCTTTTGGCTTCCTTCCAGGCGCGGCG GCTGCTGCGCTAGCTTTTTTGGCCACTGGCCGCGCGCAGCGTAAGCGGTT AGGCTGGAAAGCGAAAGCATTAAGTGGCTCGCTCCCTGTAGCCGGAGGGT TATTTTCCAAGGGTTGAGTCGCGGGACCCCCGGTTCGAGTCTCGGACCGG CCGGACTGCGGCGAACGGGGGTTTGCCTCCCCGTCATGCAAGACCCCGCT TGCAAATTCCTCCGGAAACAGGGACGAGCCCCTTTTTTGCTTTTCCCAGA TGCATCCGGTGCTGCGGCAGATGCGCCCCCCTCCTCAGCAGCGGCAAGAG CAAGAGCAGCGGCAGACATGCAGGGCACCCTCCCCTCCTCCTACCGCGTC AGGAGGGGCGACATCCGCGGTTGACGCGGCAGCAGATGGTGATTACGAAC CCCCGCGGCGCCGGGCCCGGCACTACCTGGACTTGGAGGAGGGCGAGGGC CTGGCGCGGCTAGGAGCGCCCTCTCCTGAGCGGCACCCAAGGGTGCAGCT GAAGCGTGATACGCGTGAGGCGTACGTGCCGCGGCAGAACCTGTTTCGCG ACCGCGAGGGAGAGGAGCCCGAGGAGATGCGGGATCGAAAGTTCCACGCA GGGCGCGAGCTGCGGCATGGCCTGAATCGCGAGCGGTTGCTGCGCGAGGA GGACTTTGAGCCCGACGCGCGAACCGGGATTAGTCCCGCGCGCGCACACG TGGCGGCCGCCGACCTGGTAACCGCATACGAGCAGACGGTGAACCAGGAG ATTAACTTTCAAAAAAGCTTTAACAACCACGTGCGTACGCTTGTGGCGCG CGAGGAGGTGGCTATAGGACTGATGCATCTGTGGGACTTTGTAAGCGCGC TGGAGCAAAACCCAAATAGCAAGCCGCTCATGGCGCAGCTGTTCCTTATA GTGCAGCACAGCAGGGACAACGAGGCATTCAGGGATGCGCTGCTAAACAT AGTAGAGCCCGAGGGCCGCTGGCTGCTCGATTTGATAAACATCCTGCAGA GCATAGTGGTGCAGGAGCGCAGCTTGAGCCTGGCTGACAAGGTGGCCGCC ATCAACTATTCCATGCTTAGCCTGGGCAAGTTTTACGCCCGCAAGATATA CCATACCCCTTACGTTCCCATAGACAAGGAGGTAAAGATCGAGGGGTTCT ACATGCGCATGGCGCTGAAGGTGCTTACCTTGAGCGACGACCTGGGCGTT TATCGCAACGAGCGCATCCACAAGGCCGTGAGCGTGAGCCGGCGGCGCGA GCTCAGCGACCGCGAGCTGATGCACAGCCTGCAAAGGGCCCTGGCTGGCA CGGGCAGCGGCGATAGAGAGGCCGAGTCCTACTTTGACGCGGGCGCTGAC CTGCGCTGGGCCCCAAGCCGACGCGCCCTGGAGGCAGCTGGGGCCGGACC TGGGCTGGCGGTGGCACCCGCGCGCGCTGGCAACGTCGGCGGCGTGGAGG AATATGACGAGGACGATGAGTACGAGCCAGAGGACGGCGAGTACTAAGCG GTGATGTTTCTGATCAGATGATGCAAGACGCAACGGACCCGGCGGTGCGG GCGGCGCTGCAGAGCCAGCCGTCCGGCCTTAACTCCACGGACGACTGGCG CCAGGTCATGGACCGCATCATGTCGCTGACTGCGCGCAATCCTGACGCGT TCCGGCAGCAGCCGCAGGCCAACCGGCTCTCCGCAATTCTGGAAGCGGTG GTCCCGGCGCGCGCAAACCCCACGCACGAGAAGGTGCTGGCGATCGTAAA CGCGCTGGCCGAAAACAGGGCCATCCGGCCCGACGAGGCCGGCCTGGTCT ACGACGCGCTGCTTCAGCGCGTGGCTCGTTACAACAGCGGCAACGTGCAG ACCAACCTGGACCGGCTGGTGGGGGATGTGCGCGAGGCCGTGGCGCAGCG TGAGCGCGCGCAGCAGCAGGGCAACCTGGGCTCCATGGTTGCACTAAACG CCTTCCTGAGTACACAGCCCGCCAACGTGCCGCGGGGACAGGAGGACTAC ACCAACTTTGTGAGCGCACTGCGGCTAATGGTGACTGAGACACCGCAAAG TGAGGTGTACCAGTCTGGGCCAGACTATTTTTTCCAGACCAGTAGACAAG GCCTGCAGACCGTAAACCTGAGCCAGGCTTTCAAAAACTTGCAGGGGCTG TGGGGGGTGCGGGCTCCCACAGGCGACCGCGCGACCGTGTCTAGCTTGCT GACGCCCAACTCGCGCCTGTTGCTGCTGCTAATAGCGCCCTTCACGGACA GTGGCAGCGTGTCCCGGGACACATACCTAGGTCACTTGCTGACACTGTAC CGCGAGGCCATAGGTCAGGCGCATGTGGACGAGCATACTTTCCAGGAGAT TACAAGTGTCAGCCGCGCGCTGGGGCAGGAGGACACGGGCAGCCTGGAGG CAACCCTAAACTACCTGCTGACCAACCGGCGGCAGAAGATCCCCTCGTTG CACAGTTTAAACAGCGAGGAGGAGCGCATTTTGCGCTACGTGCAGCAGAG CGTGAGCCTTAACCTGATGCGCGACGGGGTAACGCCCAGCGTGGCGCTGG ACATGACCGCGCGCAACATGGAACCGGGCATGTATGCCTCAAACCGGCCG TTTATCAACCGCCTAATGGACTACTTGCATCGCGCGGCCGCCGTGAACCC CGAGTATTTCACCAATGCCATCTTGAACCCGCACTGGCTACCGCCCCCTG GTTTCTACACCGGGGGATTCGAGGTGCCCGAGGGTAACGATGGATTCCTC TGGGACGACATAGACGACAGCGTGTTTTCCCCGCAACCGCAGACCCTGCT AGAGTTGCAACAGCGCGAGCAGGCAGAGGCGGCGCTGCGAAAGGAAAGCT TCCGCAGGCCAAGCAGCTTGTCCGATCTAGGCGCTGCGGCCCCGCGGTCA GATGCTAGTAGCCCATTTCCAAGCTTGATAGGGTCTCTTACCAGCACTCG CACCACCCGCCCGCGCCTGCTGGGCGAGGAGGAGTACCTAAACAACTCGC TGCTGCAGCCGCAGCGCGAAAAAAACCTGCCTCCGGCATTTCCCAACAAC GGGATAGAGAGCCTAGTGGACAAGATGAGTAGATGGAAGACGTACGCGCA GGAGCACAGGGACGTGCCAGGCCCGCGCCCGCCCACCCGTCGTCAAAGGC ACGACCGTCAGCGGGGTCTGGTGTGGGAGGACGATGACTCGGCAGACGAC AGCAGCGTCCTGGATTTGGGAGGGAGTGGCAACCCGTTTGCGCACCTTCG CCCCAGGCTGGGGAGAATGTTTTAAAAAAAAAAAAAGCATGATGCAAAAT AAAAAACTCACCAAGGCCATGGCACCGAGCGTTGGTTTTCTTGTATTCCC CTTAGTATGCGGCGCGCGGCGATGTATGAGGAAGGTCCTCCTCCCTCCTA CGAGAGTGTGGTGAGCGCGGCGCCAGTGGCGGCGGCGCTGGGTTCTCCCT TCGATGCTCCCCTGGACCCGCCGTTTGTGCCTCCGCGGTACCTGCGGCCT ACCGGGGGGAGAAACAGCATCCGTTACTCTGAGTTGGCACCCCTATTCGA CACCACCCGTGTGTACCTGGTGGACAACAAGTCAACGGATGTGGCATCCC TGAACTACCAGAACGACCACAGCAACTTTCTGACCACGGTCATTCAAAAC AATGACTACAGCCCGGGGGAGGCAAGCACACAGACCATCAATCTTGACGA CCGGTCGCACTGGGGCGGCGACCTGAAAACCATCCTGCATACCAACATGC CAAATGTGAACGAGTTCATGTTTACCAATAAGTTTAAGGCGCGGGTGATG GTGTCGCGCTTGCCTACTAAGGACAATCAGGTGGAGCTGAAATACGAGTG GGTGGAGTTCACGCTGCCCGAGGGCAACTACTCCGAGACCATGACCATAG ACCTTATGAACAACGCGATCGTGGAGCACTACTTGAAAGTGGGCAGACAG AACGGGGTTCTGGAAAGCGACATCGGGGTAAAGTTTGACACCCGCAACTT CAGACTGGGGTTTGACCCCGTCACTGGTCTTGTCATGCCTGGGGTATATA CAAACGAAGCCTTCCATCCAGACATCATTTTGCTGCCAGGATGCGGGGTG GACTTCACCCACAGCCGCCTGAGCAACTTGTTGGGCATCCGCAAGCGGCA ACCCTTCCAGGAGGGCTTTAGGATCACCTACGATGATCTGGAGGGTGGTA ACATTCCCGCACTGTTGGATGTGGACGCCTACCAGGCGAGCTTGAAAGAT GACACCGAACAGGGCGGGGGTGGCGCAGGCGGCAGCAACAGCAGTGGCAG CGGCGCGGAAGAGAACTCCAACGCGGCAGCCGCGGCAATGCAGCCGGTGG AGGACATGAACGATCATGCCATTCGCGGCGACACCTTTGCCACACGGGCT GAGGAGAAGCGCGCTGAGGCCGAAGCAGCGGCCGAAGCTGCCGCCCCCGC TGCGCAACCCGAGGTCGAGAAGCCTCAGAAGAAACCGGTGATCAAACCCC TGACAGAGGACAGCAAGAAACGCAGTTACAACCTAATAAGCAATGACAGC ACCTTCACCCAGTACCGCAGCTGGTACCTTGCATACAACTACGGCGACCC TCAGACCGGAATCCGCTCATGGACCCTGCTTTGCACTCCTGACGTAACCT GCGGCTCGGAGCAGGTCTACTGGTCGTTGCCAGACATGATGCAAGACCCC GTGACCTTCCGCTCCACGCGCCAGATCAGCAACTTTCCGGTGGTGGGCGC CGAGCTGTTGCCCGTGCACTCCAAGAGCTTCTACAACGACCAGGCCGTCT ACTCCCAACTCATCCGCCAGTTTACCTCTCTGACCCACGTGTTCAATCGC TTTCCCGAGAACCAGATTTTGGCGCGCCCGCCAGCCCCCACCATCACCAC CGTCAGTGAAAACGTTCCTGCTCTCACAGATCACGGGACGCTACCGCTGC GCAACAGCATCGGAGGAGTCCAGCGAGTGACCATTACTGACGCCAGACGC CGCACCTGCCCCTACGTTTACAAGGCCCTGGGCATAGTCTCGCCGCGCGT CCTATCGAGCCGCACTTTTTGAGCAAGCATGTCCATCCTTATATCGCCCA GCAATAACACAGGCTGGGGCCTGCGCTTCCCAAGCAAGATGTTTGGCGGG GCCAAGAAGCGCTCCGACCAACACCCAGTGCGCGTGCGCGGGCACTACCG CGCGCCCTGGGGCGCGCACAAACGCGGCCGCACTGGGCGCACCACCGTCG ATGACGCCATCGACGCGGTGGTGGAGGAGGCGCGCAACTACACGCCCACG CCGCCACCAGTGTCCACAGTGGACGCGGCCATTCAGACCGTGGTGCGCGG AGCCCGGCGCTATGCTAAAATGAAGAGACGGCGGAGGCGCGTAGCACGTC GCCACCGCCGCCGACCCGGCACTGCCGCCCAACGCGCGGCGGCGGCCCTG CTTAACCGCGCACGTCGCACCGGCCGACGGGCGGCCATGCGGGCCGCTCG AAGGCTGGCCGCGGGTATTGTCACTGTGCCCCCCAGGTCCAGGCGACGAG CGGCCGCCGCAGCAGCCGCGGCCATTAGTGCTATGACTCAGGGTCGCAGG GGCAACGTGTATTGGGTGCGCGACTCGGTTAGCGGCCTGCGCGTGCCCGT GCGCACCCGCCCCCCGCGCAACTAGATTGCAAGAAAAAACTACTTAGACT CGTACTGTTGTATGTATCCAGCGGCGGCGGCGCGCAACGAAGCTATGTCC AAGCGCAAAATCAAAGAAGAGATGCTCCAGGTCATCGCGCCGGAGATCTA TGGCCCCCCGAAGAAGGAAGAGCAGGATTACAAGCCCCGAAAGCTAAAGC GGGTCAAAAAGAAAAAGAAAGATGATGATGATGAACTTGACGACGAGGTG GAACTGCTGCACGCTACCGCGCCCAGGCGACGGGTACAGTGGAAAGGTCG ACGCGTAAAACGTGTTTTGCGACCCGGCACCACCGTAGTCTTTACGCCCG GTGAGCGCTCCACCCGCACCTACAAGCGCGTGTATGATGAGGTGTACGGC GACGAGGACCTGCTTGAGCAGGCCAACGAGCGCCTCGGGGAGTTTGCCTA CGGAAAGCGGCATAAGGACATGCTGGCGTTGCCGCTGGACGAGGGCAACC CAACACCTAGCCTAAAGCCCGTAACACTGCAGCAGGTGCTGCCCGCGCTT GCACCGTCCGAAGAAAAGCGCGGCCTAAAGCGCGAGTCTGGTGACTTGGC ACCCACCGTGCAGCTGATGGTACCCAAGCGCCAGCGACTGGAAGATGTCT TGGAAAAAATGACCGTGGAACCTGGGCTGGAGCCCGAGGTCCGCGTGCGG CCAATCAAGCAGGTGGCGCCGGGACTGGGCGTGCAGACCGTGGACGTTCA GATACCCACTACCAGTAGCACCAGTATTGCCACCGCCACAGAGGGCATGG AGACACAAACGTCCCCGGTTGCCTCAGCGGTGGCGGATGCCGCGGTGCAG GCGGTCGCTGCGGCCGCGTCCAAGACCTCTACGGAGGTGCAAACGGACCC GTGGATGTTTCGCGTTTCAGCCCCCCGGCGCCCGCGCCGTTCGAGGAAGT ACGGCGCCGCCAGCGCGCTACTGCCCGAATATGCCCTACATCCTTCCATT GCGCCTACCCCCGGCTATCGTGGCTACACCTACCGCCCCAGAAGACGAGC AACTACCCGACGCCGAACCACCACTGGAACCCGCCGCCGCCGTCGCCGTC GCCAGCCCGTGCTGGCCCCGATTTCCGTGCGCAGGGTGGCTCGCGAAGGA GGCAGGACCCTGGTGCTGCCAACAGCGCGCTACCACCCCAGCATCGTTTA AAAGCCGGTCTTTGTGGTTCTTGCAGATATGGCCCTCACCTGCCGCCTCC GTTTCCCGGTGCCGGGATTCCGAGGAAGAATGCACCGTAGGAGGGGCATG GCCGGCCACGGCCTGACGGGCGGCATGCGTCGTGCGCACCACCGGCGGCG GCGCGCGTCGCACCGTCGCATGCGCGGCGGTATCCTGCCCCTCCTTATTC CACTGATCGCCGCGGCGATTGGCGCCGTGCCCGGAATTGCATCCGTGGCC TTGCAGGCGCAGAGACACTGATTAAAAACAAGTTGCATGTGGAAAAATCA AAATAAAAAGTCTGGACTCTCACGCTCGCTTGGTCCTGTAACTATTTTGT AGAATGGAAGACATCAACTTTGCGTCTCTGGCCCCGCGACACGGCTCGCG CCCGTTCATGGGAAACTGGCAAGATATCGGCACCAGCAATATGAGCGGTG GCGCCTTCAGCTGGGGCTCGCTGTGGAGCGGCATTAAAAATTTCGGTTCC ACCGTTAAGAACTATGGCAGCAAGGCCTGGAACAGCAGCACAGGCCAGAT GCTGAGGGATAAGTTGAAAGAGCAAAATTTCCAACAAAAGGTGGTAGATG GCCTGGCCTCTGGCATTAGCGGGGTGGTGGACCTGGCCAACCAGGCAGTG CAAAATAAGATTAACAGTAAGCTTGATCCCCGCCCTCCCGTAGAGGAGCC TCCACCGGCCGTGGAGACAGTGTCTCCAGAGGGGCGTGGCGAAAAGCGTC CGCGCCCCGACAGGGAAGAAACTCTGGTGACGCAAATAGACGAGCCTCCC TCGTACGAGGAGGCACTAAAGCAAGGCCTGCCCACCACCCGTCCCATCGC GCCCATGGCTACCGGAGTGCTGGGCCAGCACACACCCGTAACGCTGGACC TGCCTCCCCCCGCCGACACCCAGCAGAAACCTGTGCTGCCAGGCCCGACC GCCGTTGTTGTAACCCGTCCTAGCCGCGCGTCCCTGCGCCGCGCCGCCAG CGGTCCGCGATCGTTGCGGCCCGTAGCCAGTGGCAACTGGCAAAGCACAC TGAACAGCATCGTGGGTCTGGGGGTGCAATCCCTGAAGCGCCGACGATGC TTCTGATAGCTAACGTGTCGTATGTGTGTCATGTATGCGTCCATGTCGCC GCCAGAGGAGCTGCTGAGCCGCCGCGCGCCCGCTTTCCAAGATGGCTACC CCTTCGATGATGCCGCAGTGGTCTTACATGCACATCTCGGGCCAGGACGC CTCGGAGTACCTGAGCCCCGGGCTGGTGCAGTTTGCCCGCGCCACCGAGA CGTACTTCAGCCTGAATAACAAGTTTAGAAACCCCACGGTGGCGCCTACG CACGACGTGACCACAGACCGGTCCCAGCGTTTGACGCTGCGGTTCATCCC TGTGGACCGTGAGGATACTGCGTACTCGTACAAGGCGCGGTTCACCCTAG CTGTGGGTGATAACCGTGTGCTGGACATGGCTTCCACGTACTTTGACATC CGCGGCGTGCTGGACAGGGGCCCTACTTTTAAGCCCTACTCTGGCACTGC CTACAACGCCCTGGCTCCCAAGGGTGCCCCAAATCCTTGCGAATGGGATG AAGCTGCTACTGCTCTTGAAATAAACCTAGAAGAAGAGGACGATGACAAC GAAGACGAAGTAGACGAGCAAGCTGAGCAGCAAAAAACTCACGTATTTGG GCAGGCGCCTTATTCTGGTATAAATATTACAAAGGAGGGTATTCAAATAG GTGTCGAAGGTCAAACACCTAAATATGCCGATAAAACATTTCAACCTGAA CCTCAAATAGGAGAATCTCAGTGGTACGAAACAGAAATTAATCATGCAGC TGGGAGAGTCCTAAAAAAGACTACCCCAATGAAACCATGTTACGGTTCga cgtctaagaaaccattattatcatgacattaacctataaaaataggcgta tcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctc tgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgc cgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtc ggggctggcttaactatgcggcatcagagcagattgtactgagagtgcac catatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcat caggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcgg tgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgca aggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaa aacgacggccagtgaattcgagctcggtacccggggatcctctagagtcg acctgcaggcatgcaagcttggcgtaatcatggtcatagctgtttcctgt gtgaaattgttatccgctcacaattccacacaacatacgagccggaagca taaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaatt gcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagct gcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggc gATATGCAAAACCCACAAATGAAAATGGAGGGCAAGGCATTCTTGTAAAG CAACAAAATGGAAAGCTAGAAAGTCAAGTGGAAATGCAATTTTTCTCAAC TACTGAGGCAGCCGCAGGCAATGGTGATAACTTGACTCCTAAAGTGGTAT TGTACAGTGAAGATGTAGATATAGAAACCCCAGACACTCATATTTCTTAC ATGCCCACTATTAAGGAAGGTAACTCACGAGAACTAATGGGCCAACAATC TATGCCCAACAGGCCTAATTACATTGCTTTTAGGGACAATTTTATTGGTC TAATGTATTACAACAGCACGGGTAATATGGGTGTTCTGGCGGGCCAAGCA TCGCAGTTGAATGCTGTTGTAGATTTGCAAGACAGAAACACAGAGCTTTC ATACCAGCTTTTGCTTGATTCCATTGGTGATAGAACCAGGTACTTTTCTA TGTGGAATCAGGCTGTTGACAGCTATGATCCAGATGTTAGAATTATTGAA AATCATGGAACTGAAGATGAACTTCCAAATTACTGCTTTCCACTGGGAGG TGTGATTAATACAGAGACTCTTACCAAGGTAAAACCTAAAACAGGTCAGG AAAATGGATGGGAAAAAGATGCTACAGAATTTTCAGATAAAAATGAAATA AGAGTTGGAAATAATTTTGCCATGGAAATCAATCTAAATGCCAACCTGTG GAGAAATTTCCTGTACTCCAACATAGCGCTGTATTTGCCCGACAAGCTAA AGTACAGTCCTTCCAACGTAAAAATTTCTGATAACCCAAACACCTACGAC TACATGAACAAGCGAGTGGTGGCTCCCGGGCTAGTGGACTGCTACATTAA CCTTGGAGCACGCTGGTCCCTTGACTATATGGACAACGTCAACCCATTTA ACCACCACCGCAATGCTGGCCTGCGCTACCGCTCAATGTTGCTGGGCAAT GGTCGCTATGTGCCCTTCCACATCCAGGTGCCTCAGAAGTTCTTTGCCAT TAAAAACCTCCTTCTCCTGCCGGGCTCATACACCTACGAGTGGAACTTCA GGAAGGATGTTAACATGGTTCTGCAGAGCTCCCTAGGAAATGACCTAAGG GTTGACGGAGCCAGCATTAAGTTTGATAGCATTTGCCTTTACGCCACCTT CTTCCCCATGGCCCACAACACCGCCTCCACGCTTGAGGCCATGCTTAGAA ACGACACCAACGACCAGTCCTTTAACGACTATCTCTCCGCCGCCAACATG CTCTACCCTATACCCGCCAACGCTACCAACGTGCCCATATCCATCCCCTC CCGCAACTGGGCGGCTTTCCGCGGCTGGGCCTTCACGCGCCTTAAGACTA AGGAAACCCCATCACTGGGCTCGGGCTACGACCCTTATTACACCTACTCT GGCTCTATACCCTACCTAGATGGAACCTTTTACCTCAACCACACCTTTAA GAAGGTGGCCATTACCTTTGACTCTTCTGTCAGCTGGCCTGGCAATGACC GCCTGCTTACCCCCAACGAGTTTGAAATTAAGCGCTCAGTTGACGGGGAG GGTTACAACGTTGCCCAGTGTAACATGACCAAAGACTGGTTCCTGGTACA AATGCTAGCTAACTATAACATTGGCTACCAGGGCTTCTATATCCCAGAGA GCTACAAGGACCGCATGTACTCCTTCTTTAGAAACTTCCAGCCCATGAGC CGTCAGGTGGTGGATGATACTAAATACAAGGACTACCAACAGGTGGGCAT CCTACACCAACACAACAACTCTGGATTTGTTGGCTACCTTGCCCCCACCA TGCGCGAAGGACAGGCCTACCCTGCTAACTTCCCCTATCCGCTTATAGGC AAGACCGCAGTTGACAGCATTACCCAGAAAAAGTTTCTTTGCGATCGCAC CCTTTGGCGCATCCCATTCTCCAGTAACTTTATGTCCATGGGCGCACTCA CAGACCTGGGCCAAAACCTTCTCTACGCCAACTCCGCCCACGCGCTAGAC ATGACTTTTGAGGTGGATCCCATGGACGAGCCCACCCTTCTTTATGTTTT GTTTGAAGTCTTTGACGTGGTCCGTGTGCACCAGCCGCACCGCGGCGTCA TCGAAACCGTGTACCTGCGCACGCCCTTCTCGGCCGGCAACGCCACAACA TAAAGAAGCAAGCAACATCAACAACAGCTGCCGCCATGGGCTCCAGTGAG CAGGAACTGAAAGCCATTGTCAAAGATCTTGGTTGTGGGCCATATTTTTT GGGCACCTATGACAAGCGCTTTCCAGGCTTTGTTTCTCCACACAAGCTCG CCTGCGCCATAGTCAATACGGCCGGTCGCGAGACTGGGGGCGTACACTGG ATGGCCTTTGCCTGGAACCCGCACTCAAAAACATGCTACCTCTTTGAGCC CTTTGGCTTTTCTGACCAGCGACTCAAGCAGGTTTACCAGTTTGAGTACG AGTCACTCCTGCGCCGTAGCGCCATTGCTTCTTCCCCCGACCGCTGTATA ACGCTGGAAAAGTCCACCCAAAGCGTACAGGGGCCCAACTCGGCCGCCTG TGGACTATTCTGCTGCATGTTTCTCCACGCCTTTGCCAACTGGCCCCAAA CTCCCATGGATCACAACCCCACCATGAACCTTATTACCGGGGTACCCAAC TCCATGCTCAACAGTCCCCAGGTACAGCCCACCCTGCGTCGCAACCAGGA ACAGCTCTACAGCTTCCTGGAGCGCCACTCGCCCTACTTCCGCAGCCACA GTGCGCAGATTAGGAGCGCCACTTCTTTTTGTCACTTGAAAAACATGTAA AAATAATGTACTAGAGACACTTTCAATAAAGGCAAATGCTTTTATTTGTA CACTCTCGGGTGATTATTTACCCCCACCCTTGCCGTCTGCGCCGTTTAAA AATCAAAGGGGTTCTGCCGCGCATCGCTATGCGCCACTGGCAGGGACACG TTGCGATACTGGTGTTTAGTGCTCCACTTAAACTCAGGCACAACCATCCG CGGCAGCTCGGTGAAGTTTTCACTCCACAGGCTGCGCACCATCACCAACG CGTTTAGCAGGTCGGGCGCCGATATCTTGAAGTCGCAGTTGGGGCCTCCG CCCTGCGCGCGCGAGTTGCGATACACAGGGTTGCAGCACTGGAACACTAT CAGCGCCGGGTGGTGCACGCTGGCCAGCACGCTCTTGTCGGAGATCAGAT CCGCGTCCAGGTCCTCCGCGTTGCTCAGGGCGAACGGAGTCAACTTTGGT AGCTGCCTTCCCAAAAAGGGCGCGTGCCCAGGCTTTGAGTTGCACTCGCA CCGTAGTGGCATCAAAAGGTGACCGTGCCCGGTCTGGGCGTTAGGATACA GCGCCTGCATAAAAGCCTTGATCTGCTTAAAAGCCACCTGAGCCTTTGCG CCTTCAGAGAAGAACATGCCGCAAGACTTGCCGGAAAACTGATTGGCCGG ACAGGCCGCGTCGTGCACGCAGCACCTTGCGTCGGTGTTGGAGATCTGCA CCACATTTCGGCCCCACCGGTTCTTCACGATCTTGGCCTTGCTAGACTGC TCCTTCAGCGCGCGCTGCCCGTTTTCGCTCGTCACATCCATTTCAATCAC GTGCTCCTTATTTATCATAATGCTTCCGTGTAGACACTTAAGCTCGCCTT CGATCTCAGCGCAGCGGTGCAGCCACAACGCGCAGCCCGTGGGCTCGTGA TGCTTGTAGGTCACCTCTGCAAACGACTGCAGGTACGCCTGCAGGAATCG CCCCATCATCGTCACAAAGGTCTTGTTGCTGGTGAAGGTCAGCTGCAACC CGCGGTGCTCCTCGTTCAGCCAGGTCTTGCATACGGCCGCCAGAGCTTCC ACTTGGTCAGGCAGTAGTTTGAAGTTCGCCTTTAGATCGTTATCCACGTG GTACTTGTCCATCAGCGCGCGCGCAGCCTCCATGCCCTTCTCCCACGCAG ACACGATCGGCACACTCAGCGGGTTCATCACCGTAATTTCACTTTCCGCT TCGCTGGGCTCTTCCTCTTCCTCTTGCGTCCGCATACCACGCGCCACTGG GTCGTCTTCATTCAGCCGCCGCACTGTGCGCTTACCTCCTTTGCCATGCT TGATTAGCACCGGTGGGTTGCTGAAACCCACCATTTGTAGCGCCACATCT TCTCTTTCTTCCTCGCTGTCCACGATTACCTCTGGTGATGGCGGGCGCTC GGGCTTGGGAGAAGGGCGCTTCTTTTTCTTCTTGGGCGCAATGGCCAAAT CCGCCGCCGAGGTCGATGGCCGCGGGCTGGGTGTGCGCGGCACCAGCGCG TCTTGTGATGAGTCTTCCTCGTCCTCGGACTCGATACGCCGCCTCATCCG CTTTTTTGGGGGCGCCCGGGGAGGCGGCGGCGACGGGGACGGGGACGACA CGTCCTCCATGGTTGGGGGACGTCGCGCCGCACCGCGTCCGCGCTCGGGG GTGGTTTCGCGCTGCTCCTCTTCCCGACTGGCCATTTCCTTCTCCTATAG GCAGAAAAAGATCATGGAGTCAGTCGAGAAGAAGGACAGCCTAACCGCCC CCTCTGAGTTCGCCACCACCGCCTCCACCGATGCCGCCAACGCGCCTACC ACCTTCCCCGTCGAGGCACCCCCGCTTGAGGAGGAGGAAGTGATTATCGA GCAGGACCCAGGTTTTGTAAGCGAAGACGACGAGGACCGCTCAGTACCAA CAGAGGATAAAAAGCAAGACCAGGACAACGCAGAGGCAAACGAGGAACAA GTCGGGCGGGGGGACGAAAGGCATGGCGACTACCTAGATGTGGGAGACGA CGTGCTGTTGAAGCATCTGCAGCGCCAGTGCGCCATTATCTGCGACGCGT TGCAAGAGCGCAGCGATGTGCCCCTCGCCATAGCGGATGTCAGCCTTGCC TACGAACGCCACCTATTCTCACCGCGCGTACCCCCCAAACGCCAAGAAAA CGGCACATGCGAGCCCAACCCGCGCCTCAACTTCTACCCCGTATTTGCCG TGCCAGAGGTGCTTGCCACCTATCACATCTTTTTCCAAAACTGCAAGATA CCCCTATCCTGCCGTGCCAACCGCAGCCGAGCGGACAAGCAGCTGGCCTT GCGGCAGGGCGCTGTCATACCTGATATCGCCTCGCTCAACGAAGTGCCAA AAATCTTTGAGGGTCTTGGACGCGACGAGAAGCGCGCGGCAAACGCTCTG CAACAGGAAAACAGCGAAAATGAAAGTCACTCTGGAGTGTTGGTGGAACT CGAGGGTGACAACGCGCGCCTAGCCGTACTAAAACGCAGCATCGAGGTCA CCCACTTTGCCTACCCGGCACTTAACCTACCCCCCAAGGTCATGAGCACA GTCATGAGTGAGCTGATCGTGCGCCGTGCGCAGCCCCTGGAGAGGGATGC AAATTTGCAAGAACAAACAGAGGAGGGCCTACCCGCAGTTGGCGACGAGC AGCTAGCGCGCTGGCTTCAAACGCGCGAGCCTGCCGACTTGGAGGAGCGA CGCAAACTAATGATGGCCGCAGTGCTCGTTACCGTGGAGCTTGAGTGCAT GCAGCGGTTCTTTGCTGACCCGGAGATGCAGCGCAAGCTAGAGGAAACAT TGCACTACACCTTTCGACAGGGCTACGTACGCCAGGCCTGCAAGATCTCC AACGTGGAGCTCTGCAACCTGGTCTCCTACCTTGGAATTTTGCACGAAAA CCGCCTTGGGCAAAACGTGCTTCATTCCACGCTCAAGGGCGAGGCGCGCC GCGACTACGTCCGCGACTGCGTTTACTTATTTCTATGCTACACCTGGCAG ACGGCCATGGGCGTTTGGCAGCAGTGCTTGGAGGAGTGCAACCTCAAGGA GCTGCAGAAACTGCTAAAGCAAAACTTGAAGGACCTATGGACGGCCTTCA ACGAGCGCTCCGTGGCCGCGCACCTGGCGGACATCATTTTCCCCGAACGC CTGCTTAAAACCCTGCAACAGGGTCTGCCAGACTTCACCAGTCAAAGCAT GTTGCAGAACTTTAGGAACTTTATCCTAGAGCGCTCAGGAATCTTGCCCG CCACCTGCTGTGCACTTCCTAGCGACTTTGTGCCCATTAAGTACCGCGAA TGCCCTCCGCCGCTTTGGGGCCACTGCTACCTTCTGCAGCTAGCCAACTA CCTTGCCTACCACTCTGACATAATGGAAGACGTGAGCGGTGACGGTCTAC TGGAGTGTCACTGTCGCTGCAACCTATGCACCCCGCACCGCTCCCTGGTT TGCAATTCGCAGCTGCTTAACGAAAGTCAAATTATCGGTACCTTTGAGCT GCAGGGTCCCTCGCCTGACGAAAAGTCCGCGGCTCCGGGGTTGAAACTCA CTCCGGGGCTGTGGACGTCGGCTTACCTTCGCAAATTTGTACCTGAGGAC TACCACGCCCACGAGATTAGGTTCTACGAAGACCAATCCCGCCCGCCTAA TGCGGAGCTTACCGCCTGCGTCATTACCCAGGGCCACATTCTTGGCCAAT TGCAAGCCATCAACAAAGCCCGCCAAGAGTTTCTGCTACGAAAGGGACGG GGGGTTTACTTGGACCCCCAGTCCGGCGAGGAGCTCAACCCAATCCCCCC GCCGCCGCAGCCCTATCAGCAGCAGCCGCGGGCCCTTGCTTCCCAGGATG GCACCCAAAAAGAAGCTGCAGCTGCCGCCGCCACCCACGGACGAGGAGGA ATACTGGGACAGTCAGGCAGAGGAGGTTTTGGACGAGGAGGAGGAGGACA TGATGGAAGACTGGGAGAGCCTAGACGAGGAAGCTTCCGAGGTCGAAGAG GTGTCAGACGAAACACCGTCACCCTCGGTCGCATTCCCCTCGCCGGCGCC CCAGAAATCGGCAACCGGTTCCAGCATGGCTACAACCTCCGCTCCTCAGG CGCCGCCGGCACTGCCCGTTCGCCGACCCAACCGTAGATGGGACACCACT GGAACCAGGGCCGGTAAGTCCAAGCAGCCGCCGCCGTTAGCCCAAGAGCA ACAACAGCGCCAAGGCTACCGCTCATGGCGCGGGCACAAGAACGCCATAG TTGCTTGCTTGCAAGACTGTGGGGGCAACATCTCCTTCGCCCGCCGCTTT CTTCTCTACCATCACGGCGTGGCCTTCCCCCGTAACATCCTGCATTACTA CCGTCATCTCTACAGCCCATACTGCACCGGCGGCAGCGGCAGCAACAGCA GCGGCCACACAGAAGCAAAGGCGACCGGATAGCAAGACTCTGACAAAGCC CAAGAAATCCACAGCGGCGGCAGCAGCAGGAGGAGGAGCGCTGCGTCTGG CGCCCAACGAACCCGTATCGACCCGCGAGCTTAGAAACAGGATTTTTCCC ACTCTGTATGCTATATTTCAACAGAGCAGGGGCCAAGAACAAGAGCTGAA AATAAAAAACAGGTCTCTGCGATCCCTCACCCGCAGCTGCCTGTATCACA AAAGCGAAGATCAGCTTCGGCGCACGCTGGAAGACGCGGAGGCTCTCTTC AGTAAATACTGCGCGCTGACTCTTAAGGACTAGTTTCGCGCCCTTTCTCA AATTTAAGCGCGAAAACTACGTCATCTCCAGCGGCCACACCCGGCGCCAG CACCTGTTGTCAGCGCCATTATGAGCAAGGAAATTCCCACGCCCTACATG TGGAGTTACCAGCCACAAATGGGACTTGCGGCTGGAGCTGCCCAAGACTA CTCAACCCGAATAAACTACATGAGCGCGGGACCCCACATGATATCCCGGG TCAACGGAATACGCGCCCACCGAAACCGAATTCTCCTGGAACAGGCGGCT ATTACCACCACACCTCGTAATAACCTTAATCCCCGTAGTTGGCCCGCTGC CCTGGTGTACCAGGAAAGTCCCGCTCCCACCACTGTGGTACTTCCCAGAG ACGCCCAGGCCGAAGTTCAGATGACTAACTCAGGGGCGCAGCTTGCGGGC GGCTTTCGTCACAGGGTGCGGTCGCCCGGGCAGGGTATAACTCACCTGAC AATCAGAGGGCGAGGTATTCAGCTCAACGACGAGTCGGTGAGCTCCTCGC TTGGTCTCCGTCCGGACGGGACATTTCAGATCGGCGGCGCCGGCCGCTCT TCATTCACGCCTCGTCAGGCAATCCTAACTCTGCAGACCTCGTCCTCTGA GCCGCGCTCTGGAGGCATTGGAACTCTGCAATTTATTGAGGAGTTTGTGC CATCGGTCTACTTTAACCCCTTCTCGGGACCTCCCGGCCACTATCCGGAT CAATTTATTCCTAACTTTGACGCGGTAAAGGACTCGGCGGACGGCTACGA CTGAATGTTAAGTGGAGAGGCAGAGCAACTGCGCCTGAAACACCTGGTCC ACTGTCGCCGCCACAAGTGCTTTGCCCGCGACTCCGGTGAGTTTTGCTAC TTTGAATTGCCCGAGGATCATATCGAGGGCCCGGCGCACGGCGTCCGGCT TACCGCCCAGGGAGAGCTTGCCCGTAGCCTGATTCGGGAGTTTACCCAGC GCCCCCTGCTAGTTGAGCGGGACAGGGGACCCTGTGTTCTCACTGTGATT TGCAACTGTCCTAACCCTGGATTACATCAAGATCTTTGTTGCCATCTCTG TGCTGAGTATAATAAATACAGAAATTAAAATATACTGGGGCTCCTATCGC CATCCTGTAAACGCCACCGTCTTCACCCGCCCAAGCAAACCAAGGCGAAC CTTACCTGGTACTTTTAACATCTCTCCCTCTGTGATTTACAACAGTTTCA ACCCAGACGGAGTGAGTCTACGAGAGAACCTCTCCGAGCTCAGCTACTCC ATCAGAAAAAACACCACCCTCCTTACCTGCCGGGAACGTACGAGTGCGTC ACCGGCCGCTGCACCACACCTACCGCCTGACCGTAAACCAGACTTTTTCC GGACAGACCTCAATAACTCTGTTTACCAGAACAGGAGGTGAGCTTAGAAA ACCCTTAGGGTATTAGGCCAAAGGCGCAGCTACTGTGGGGTTTATGAACA ATTCAAGCAACTCTACGGGCTATTCTAATTCAGGTTTCTCTAGAATCGGG GTTGGGGTTATTCTCTGTCTTGTGATTCTCTTTATTCTTATACTAACGCT TCTCTGCCTAAGGCTCGCCGCCTGCTGTGTGCACATTTGCATTTATTGTC AGCTTTTTAAACGCTGGGGTCGCCACCCAAGATGATTAGGTACATAATCC TAGGTTTACTCACCCTTGCGTCAGCCCACGGTACCACCCAAAAGGTGGAT TTTAAGGAGCCAGCCTGTAATGTTACATTCGCAGCTGAAGCTAATGAGTG CACCACTCTTATAAAATGCACCACAGAACATGAAAAGCTGCTTATTCGCC ACAAAAACAAAATTGGCAAGTATGCTGTTTATGCTATTTGGCAGCCAGGT GACACTACAGAGTATAATGTTACAGTTTTCCAGGGTAAAAGTCATAAAAC TTTTATGTATACTTTTCCATTTTATGAAATGTGCGACATTACCATGTACA TGAGCAAACAGTATAAGTTGTGGCCCCCACAAAATTGTGTGGAAAACACT GGCACTTTCTGCTGCACTGCTATGCTAATTACAGTGCTCGCTTTGGTCTG TACCCTACTCTATATTAAATACAAAAGCAGACGCAGCTTTATTGAGGAAA AGAAAATGCCTTAATTTACTAAGTTACAAAGCTAATGTCACCACTAACTG CTTTACTCGCTGCTTGCAAAACAAATTCAAAAAGTTAGCATTATAATTAG AATAGGATTTAAACCCCCCGGTCATTTCCTGCTCAATACCATTCCCCTGA ACAATTGACTCTATGTGGGATATGCTCCAGCGCTACAACCTTGAAGTCAG GCTTCCTGGATGTCAGCATCTGACTTTGGCCAGCACCTGTCCCGCGGATT TGTTCCAGTCCAACTACAGCGACCCACCCTAACAGAGATGACCAACACAA CCAACGCGGCCGCCGCTACCGGACTTACATCTACCACAAATACACCCCAA GTTTCTGCCTTTGTCAATAACTGGGATAACTTGGGCATGTGGTGGTTCTC CATAGCGCTTATGTTTGTATGCCTTATTATTATGTGGCTCATCTGCTGCC TAAAGCGCAAACGCGCCCGACCACCCATCTATAGTCCCATCATTGTGCTA CACCCAAACAATGATGGAATCCATAGATTGGACGGACTGAAACACATGTT CTTTTCTCTTACAGTATGATTAAATGAGACATGATTCCTCGAGTTTTTAT ATTACTGACCCTTGTTGCGCTTTTTTGTGCGTGCTCCACATTGGCTGCGG TTTCTCACATCGAAGTAGACTGCATTCCAGCCTTCACAGTCTATTTGCTT TACGGATTTGTCACCCTCACGCTCATCTGCAGCCTCATCACTGTGGTCAT CGCCTTTATCCAGTGCATTGACTGGGTCTGTGTGCGCTTTGCATATCTCA GACACCATCCCCAGTACAGGGACAGGACTATAGCTGAGCTTCTTAGAATT CTTTAATTATGAAATTTACTGTGACTTTTCTGCTGATTATTTGCACCCTA TCTGCGTTTTGTTCCCCGACCTCCAAGCCTCAAAGACATATATCATGCAG ATTCACTCGTATATGGAATATTCCAAGTTGCTACAATGAAAAAAGCGATC TTTCCGAAGCCTGGTTATATGCAATCATCTCTGTTATGGTGTTCTGCAGT ACCATCTTAGCCCTAGCTATATATCCCTACCTTGACATTGGCTGGAACGC AATAGATGCCATGAACCACCCAACTTTCCCCGCGCCCGCTATGCTTCCAC TGCAACAAGTTGTTGCCGGCGGCTTTGTCCCAGCCAATCAGCCTCGCCCA CCTTCTCCCACCCCCACTGAAATCAGCTACTTTAATCTAACAGGAGGAGA TGACTGACACCCTAGATCTAGAAATGGACGGAATTATTACAGAGCAGCGC CTGCTAGAAAGACGCAGGGCAGCGGCCGAGCAACAGCGCATGAATCAAGA GCTCCAAGACATGGTTAACTTGCACCAGTGCAAAAGGGGTATCTTTTGTC TCGTAAAGCAGGCCAAAGTCACCTACGACAGTAATACCACCGGACACCGC CTTAGCTACAAGTTGCCAACCAAGCGTCAGAAATTGGTGGTCATGGTGGG AGAAAAGCCCATTACCATAACTCAGCACTCGGTAGAAACCGAAGGCTGCA TTCACTCACCTTGTCAAGGACCTGAGGATCTCTGCACCCTTATTAAGACC CTGTGCGGTCTCAAAGATCTTATTCCCTTTAACTAATAAAAAAAAATAAT AAAGCATCACTTACTTAAAATCAGTTAGCAAATTTCTGTCCAGTTTATTC AGCAGCACCTCCTTGCCCTCCTCCCAGCTCTGGTATTGCAGCTTCCTCCT GGCTGCAAACTTTCTCCACAATCTAAATGGAATGTCAGTTTCCTCCTGTT CCTGTCCATCCGCACCCACTATCTTCATGTTGTTGCAGATGAAGCGCGCA AGACCGTCTgaagataccttcaaccccgtgtatccgtacgacacggaaac cggtcctccaactgtgccTTTTCTTACTCCTCCCTTTGTATCCCCCAATG GGTTTCAAGAGAGTCCCCCTGGGGTACTCTCTTTGCGCCTATCCGAACCT CTAGTTACCTCCAATGGCATGCTTGCGCTCAAAATGGGCAACGGCCTCTC TCTGGACGAGGCCGGCAACCTTACCTCCCAAAATGTAACCACTGTGAGCC CACCTCTCAAAAAAACCAAGTCAAACATAAACCTGGAAATATCTGCACCC CTCACAGTTACCTCAGAAGCCCTAACTGTGGCTGCCGCCGCACCTCTAAT GGTCGCGGGCAACACACTCACCATGCAATCACAGGCCCCGCTAACCGTGC ACGACTCCAAACTTAGCATTGCCACCCAAGGACCCCTCACAGTGTCAGAA GGAAAGCTAGCCCTGCAAACATCAGGCCCCCTCACCACCACCGATAGCAG TACCCTTACTATCACTGCCTCACCCCCTCTAACTACTGCCACTGGTAGCT TGGGCATTGACTTGAAAGAGCCCATTTATACACAAAATGGAAAACTAGGA CTAAAGTACGGGGCTCCTTTGCATGTAACAGACGACCTAAACACTTTGAC CGTAGCAACTGGTCCAGGTGTGACTATTAATAATACTTCCTTGCAAACTA AAGTTACTGGAGCCTTGGGTTTTGATTCACAAGGCAATATGCAACTTAAT GTAGCAGGAGGACTAAGGATTGATTCTCAAAACAGACGCCTTATACTTGA TGTTAGTTATCCGTTTGATGCTCAAAACCAACTAAATCTAAGACTAGGAC AGGGCCCTCTTTTTATAAACTCAGCCCACAACTTGGATATTAACTACAAC AAAGGCCTTTACTTGTTTACAGCTTCAAACAATTCCAAAAAGCTTGAGGT TAACCTAAGCACTGCCAAGGGGTTGATGTTTGACGCTACAGCCATAGCCA TTAATGCAGGAGATGGGCTTGAATTTGGTTCACCTAATGCACCAAACACA AATCCCCTCAAAACAAAAATTGGCCATGGCCTAGAATTTGATTCAAACAA GGCTATGGTTCCTAAACTAGGAACTGGCCTTAGTTTTGACAGCACAGGTG CCATTACAGTAGGAAACAAAAATAATGATAAGCTAACTTTGTGGACCACA CCAGCTCCATCTCCTAACTGTAGACTAAATGCAGAGAAAGATGCTAAACT CACTTTGGTCTTAACAAAATGTGGCAGTCAAATACTTGCTACAGTTTCAG TTTTGGCTGTTAAAGGCAGTTTGGCTCCAATATCTGGAACAGTTCAAAGT GCTCATCTTATTATAAGATTTGACGAAAATGGAGTGCTACTAAACAATTC CTTCCTGGACCCAGAATATTGGAACTTTAGAAATGGAGATCTTACTGAAG GCACAGCCTATACAAACGCTGTTGGATTTATGCCTAACCTATCAGCTTAT CCAAAATCTCACGGTAAAACTGCCAAAAGTAACATTGTCAGTCAAGTTTA CTTAAACGGAGACAAAACTAAACCTGTAACACTAACCATTACACTAAACG GTACACAGGAAACAGGAGACACAACTCCAAGTGCATACTCTATGTCATTT TCATGGGACTGGTCTGGCCACAACTACATTAATGAAATATTTGCCACATC CTCTTACACTTTTTCATACATTGCCCAAGAATAAAGAATCGTTTGTGTTA TGTTTCAACGTGTTTATTTTTCAATTGCAGAAAATTTCAAGTCATTTTTC ATTCAGTAGTATAGCCCCACCACCACATAGCTTATACAGATCACCGTACC TTAATCAAACTCACAGAACCCTAGTATTCAACCTGCCACCTCCCTCCCAA CACACAGAGTACACAGTCCTTTCTCCCCGGCTGGCCTTAAAAAGCATCAT ATCATGGGTAACAGACATATTCTTAGGTGTTATATTCCACACGGTTTCCT GTCGAGCCAAACGCTCATCAGTGATATTAATAAACTCCCCGGGCAGCTCA CTTAAGTTCATGTCGCTGTCCAGCTGCTGAGCCACAGGCTGCTGTCCAAC TTGCGGTTGCTTAACGGGCGGCGAAGGAGAAGTCCACGCCTACATGGGGG TAGAGTCATAATCGTGCATCAGGATAGGGCGGTGGTGCTGCAGCAGCGCG CGAATAAACTGCTGCCGCCGCCGCTCCGTCCTGCAGGAATACAACATGGC AGTGGTCTCCTCAGCGATGATTCGCACCGCCCGCAGCATAAGGCGCCTTG TCCTCCGGGCACAGCAGCGCACCCTGATCTCACTTAAATCAGCACAGTAA CTGCAGCACAGCACCACAATATTGTTCAAAATCCCACAGTGCAAGGCGCT GTATCCAAAGCTCATGGCGGGGACCACAGAACCCACGTGGCCATCATACC ACAAGCGCAGGTAGATTAAGTGGCGACCCCTCATAAACACGCTGGACATA AACATTACCTCTTTTGGCATGTTGTAATTCACCACCTCCCGGTACCATAT AAACCTCTGATTAAACATGGCGCCATCCACCACCATCCTAAACCAGCTGG CCAAAACCTGCCCGCCGGCTATACACTGCAGGGAACCGGGACTGGAACAA TGACAGTGGAGAGCCCAGGACTCGTAACCATGGATCATCATGCTCGTCAT GATATCAATGTTGGCACAACACAGGCACACGTGCATACACTTCCTCAGGA TTACAAGCTCCTCCCGCGTTAGAACCATATCCCAGGGAACAACCCATTCC TGAATCAGCGTAAATCCCACACTGCAGGGAAGACCTCGCACGTAACTCAC GTTGTGCATTGTCAAAGTGTTACATTCGGGCAGCAGCGGATGATCCTCCA GTATGGTAGCGCGGGTTTCTGTCTCAAAAGGAGGTAGACGATCCCTACTG TACGGAGTGCGCCGAGACAACCGAGATCGTGTTGGTCGTAGTGTCATGCC AAATGGAACGCCGGACGTAGTCATATTTCCTGAAGCAAAACCAGGTGCGG GCGTGACAAACAGATCTGCGTCTCCGGTCTCGCCGCTTAGATCGCTCTGT GTAGTAGTTGTAGTATATCCACTCTCTCAAAGCATCCAGGCGCCCCCTGG CTTCGGGTTCTATGTAAACTCCTTCATGCGCCGCTGCCCTGATAACATCC ACCACCGCAGAATAAGCCACACCCAGCCAACCTACACATTCGTTCTGCGA GTCACACACGGGAGGAGCGGGAAGAGCTGGAAGAACCATGTTTTTTTTTT TATTCCAAAAGATTATCCAAAACCTCAAAATGAAGATCTATTAAGTGAAC GCGCTCCCCTCCGGTGGCGTGGTCAAACTCTACAGCCAAAGAACAGATAA TGGCATTTGTAAGATGTTGCACAATGGCTTCCAAAAGGCAAACGGCCCTC ACGTCCAAGTGGACGTAAAGGCTAAACCCTTCAGGGTGAATCTCCTCTAT AAACATTCCAGCACCTTCAACCATGCCCAAATAATTCTCATCTCGCCACC TTCTCAATATATCTCTAAGCAAATCCCGAATATTAAGTCCGGCCATTGTA AAAATCTGCTCCAGAGCGCCCTCCACCTTCAGCCTCAAGCAGCGAATCAT GATTGCAAAAATTCAGGTTCCTCACAGACCTGTATAAGATTCAAAAGCGG AACATTAACAAAAATACCGCGATCCCGTAGGTCCCTTCGCAGGGCCAGCT GAACATAATCGTGCAGGTCTGCACGGACCAGCGCGGCCACTTCCCCGCCA GGAACCATGACAAAAGAACCCACACTGATTATGACACGCATACTCGGAGC TATGCTAACCAGCGTAGCCCCGATGTAAGCTTGTTGCATGGGCGGCGATA TAAAATGCAAGGTGCTGCTCAAAAAATCAGGCAAAGCCTCGCGCAAAAAA GAAAGCACATCGTAGTCATGCTCATGCAGATAAAGGCAGGTAAGCTCCGG AACCACCACAGAAAAAGACACCATTTTTCTCTCAAACATGTCTGCGGGTT TCTGCATAAACACAAAATAAAATAACAAAAAAACATTTAAACATTAGAAG CCTGTCTTACAACAGGAAAAACAACCCTTATAAGCATAAGACGGACTACG GCCATGCCGGCGTGACCGTAAAAAAACTGGTCACCGTGATTAAAAAGCAC CACCGACAGCTCCTCGGTCATGTCCGGAGTCATAATGTAAGACTCGGTAA ACACATCAGGTTGATTCACATCGGTCAGTGCTAAAAAGCGACCGAAATAG CCCGGGGGAATACATACCCGCAGGCGTAGAGACAACATTACAGCCCCCAT AGGAGGTATAACAAAATTAATAGGAGAGAAAAACACATAAACACCTGAAA AACCCTCCTGCCTAGGCAAAATAGCACCCTCCCGCTCCAGAACAACATAC AGCGCTTCCACAGCGGCAGCCATAACAGTCAGCCTTACCAGTAAAAAAGA AAACCTATTAAAAAAACACCACTCGACACGGCACCAGCTCAATCAGTCAC AGTGTAAAAAAGGGCCAAGTGCAGAGCGAGTATATATAGGACTAAAAAAT GACGTAACGGTTAAAGTCCACAAAAAACACCCAGAAAACCGCACGCGAAC CTACGCCCAGAAACGAAAGCCAAAAAACCCACAACTTCCTCAAATCGTCA CTTCCGTTTTCCCACGTTACGTCACTTCCCATTTTAAGAAAACTACAATT CCCAACACATACAAGTTACTCCGCCCTAAAACCTACGTCACCCGCCCCGT TCCCACGCCCCGCGCCACGTCACAAACTCCACCCCCTCATTATCATATTG GCTTCAATCCAAAATAAGGTATATTATTGATGATGTTAATTAAGAATTCG GATCTGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCT TCCGGCGGCATCGGGATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAGGT AGATGACGACCATCAGGGACAGCTTCAAGGCCAGCAAAAGGCCAGGAACC GTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGAC GAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGG ACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTC CTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCG GGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGT GTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGC CCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTA AGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAG AGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACT ACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCA GTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCAC CGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAA AAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCT CAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAA AAGGATCTTCACCTAGATCCTTTTAAATCAATCTAAAGTATATATGAGTA AACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAG CGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAG ATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGAT ACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGC CAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCC ATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGT TAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCAC GCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGG CGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGG TCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGG TTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGC TTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTAT GCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGC CACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGG CGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACC CACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTT CTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGG GCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTG AAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTA TTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTG CCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAA TAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTGGATCCGAATTCTT AATTAA

Personal tools