Prbbbb:vector pcr: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(New page: ==Overview== PCR reaction to generate linearized construction vector backbones for Fusion(Freiburg)-formatted Biobrick assemblies. ==Materials== *100 ul + PCR tubes *Phusion HotStart Po...)
 
 
(44 intermediate revisions by the same user not shown)
Line 1: Line 1:
[[PrbbBB:Protocols| Back to all protocols]]
==Overview==
==Overview==


PCR reaction to generate linearized construction vector backbones for Fusion(Freiburg)-formatted Biobrick assemblies.
A PCR reaction to generate linearized construction vector backbones for Fusion(Freiburg)-formatted Biobrick assemblies.
 
The classic assembly protocol digests the target vector (usually pSB1*) in parallel to the digestions of the two Biobrick parts. We prefer to create a stock of target backbone by PCR with a fast high-fidelity polymerase. This way, mutations in the ccdB death cassette of the target vector cannot escape selection.


==Materials==
==Materials==


*100 ul + PCR tubes
*100 ul + PCR tubes
*Phusion HotStart Polymerase 2 U/ul
*[[Phusion]] HotStart Polymerase 2 U/ul
*Phusion HF Buffer 5x
*Phusion HF Buffer 5x
*dNTP mix 10mM each nucleotide
*dNTP mix 10mM each nucleotide
*ddH2O
*ddH2O
*reverse prefix primer rg0301 (fusion format)
*reverse prefix primer [http://brickit.crg.es/registry/biobrick/190/ rg0301 (CRG)] -- [http://partsregistry.org/Part:BBa_J18910 -- BBa_J18910] (RFC 25 format, ACCGGTTAATACTAGTAGCGGCC)
*reverse suffix primer rg0302 (fusion format)
*reverse suffix primer [http://brickit.crg.es/registry/biobrick/191/ rg0302 (CRG)] -- [http://partsregistry.org/Part:BBa_J18911 BBa_J18911](RFC 25 format, GCCGGCCATCTAGAAGCG)
*vector template DNA
*vector template DNA
**pSB1AC3F -- BBa_J18901
**[http://brickit.crg.es/registry/vector/11/ pSB1AC3F (CRG)] -- [http://partsregistry.org/Part:BBa_J18901 BBa_J18901]
**pSB1AK3F -- BBa_J18902
**[http://brickit.crg.es/registry/vector/12/ pSB1AK3F (CRG)] -- [http://partsregistry.org/Part:BBa_J18901 BBa_J18902]
**pSB1AT3F -- BBa_J18903
**[http://brickit.crg.es/registry/vector/13/ pSB1AT3F (CRG)] -- [http://partsregistry.org/Part:BBa_J18901 BBa_J18903]
* [[DpnI]] restriction enzyme
* [[Antarctic Phosphatase]] and 10 x buffer


==Procedure==
==Procedure==
#Step 1: setup PCR reaction


<table frame=box>
'''setup PCR reaction'''
<tr align=center>
 
<td width=300></td> <th width=40>µl, single reaction</th> <th width=40>3.5xMaster</th> <th width=40>10xMaster</th></tr>
  <table frame=box>
  <tr align=right>
  <td></td> <th width=100>µl, single reaction</th> <th width=100>3.5xMaster</th> <th width=100>10xMaster</th></tr>
 
  <tr align=right> <td>H2O</td>              <td>76µl</td>    <td>266</td>    <td>760</td> </tr>
  <tr align=right> <td>5x HF Buffer</td>      <td>20µl</td>    <td>70</td>    <td>200</td> </tr>
  <tr align=right> <td>10mM dNTP</td>        <td>2µl</td>    <td>7</td>    <td>20</td> </tr>
  <tr><td></td></tr>
  <tr align=right> <td>rg0301 100 µM</td>    <td>0.5µl</td>    <td>1.75</td>  <td>5</td> </tr>
  <tr align=right> <td>rg0302 100 µM</td>    <td>0.5µl</td>    <td>1.75</td>  <td>5</td> </tr>
  <tr align=right> <td>Phusion</td>          <td>1µl</td>      <td>3.5</td>    <td>10</td> </tr>
  <tr><td></td></tr>
  <tr align=right> <td>template DNA</td>      <td>0.1µl</td>    <td>--</td>    <td>--</td> </tr>
 
  </table>
 
'''PCR program'''


<tr align=right> <td>H2O</td>              <td>76µl</td>    <td>266</td>    <td>760</td> </tr>
*30"@98C;
<tr align=right> <td>5x HF Buffer</td>      <td>20µl</td>    <td>70</td>    <td>200</td> </tr>
*35x (10"@98&deg;C; 15"@68C; 1'30"@72C);
<tr align=right> <td>10mM dNTP</td>        <td>2µl</td>    <td>70</td>    <td>200</td> </tr>
*10'@72C;
<tr><td></td></tr>
*inf. 4C
<tr align=right> <td>rg0301 100 µM</td>    <td>0.5µl</td>    <td>1.75</td>  <td>5</td> </tr>
<tr align=right> <td>rg0302 100 µM</td>    <td>0.5µl</td>    <td>1.75</td>  <td>5</td> </tr>
<tr align=right> <td>Phusion</td>          <td>1µl</td>      <td>3.5</td>    <td>10</td> </tr>
<tr><td></td></tr>
<tr align=right> <td>template DNA</td>      <td>0.1µl</td>    <td>0.35</td>    <td>1</td> </tr>


</table>
'''Post-Processing'''


#Step 2
# add 1µl DpnI, incubate for 1h @ 37&deg;C
#*Step 2 has some additional information that goes with it.  i.e. Keep at 4&deg;C.
#* mix the tube so that the enzyme contacts all surfaces
#Step 3
#* longer (2h) incubation may still reduce background
##Step 3 has multiple sub-steps within it.
# heat-inactivate 20'@80&deg;C
##Enumerate each of those.
# purify with PCR purification kit
#*elute in water **not** elution buffer
# dilute to 28 ng/µl (we assume a 10 % dilution by the following Phosphatase treatment)
# proceed with restriction C
#* add 2µl restriction mix C to each 8µl DNA
#* incubate for 3h @ 37°C
#* heat-inactivate 20' @ 80°C
# proceed with [[Phosphatase_treatment_of_linearized_vector | phosphatase treatment]]
#* add 10 x antarctic phospatase buffer to 1 x final concentration
#* add 1µl [[Antarctic Phosphatase]]
#* incubate 1h @ 37°C; heat-inactivate 5' @ 65°C
# verify samples on 1% Agarose gel


==Notes==
==Notes==
Line 51: Line 78:


==References==
==References==
'''Relevant papers and books'''
<!-- If this protocol has papers or books associated with it, list those references here.  See the [[OpenWetWare:Biblio]] page for more information. -->
<!-- If this protocol has papers or books associated with it, list those references here.  See the [[OpenWetWare:Biblio]] page for more information. -->
<!--
'''Example reference'''
<biblio>
<biblio>
#Goldbeter-PNAS-1981 pmid=6947258
#Jacob-JMB-1961 pmid=13718526
#Ptashne-Genetic-Switch isbn=0879697164
#Ptashne-Genetic-Switch isbn=0879697164
</biblio>
</biblio>
-->


==Contact==
==Contact==
*Who has experience with this protocol?
*[[Special:Emailuser/Raik|Raik]]


or instead, [[Talk:{{PAGENAME}}|discuss this protocol]].  
or instead, [[Talk:{{PAGENAME}}|discuss this protocol]].  
Line 66: Line 93:
<!-- You can tag this protocol with various categories.  See the [[Categories]] page for more information. -->
<!-- You can tag this protocol with various categories.  See the [[Categories]] page for more information. -->
[[Category:Protocol]]
[[Category:Protocol]]
[[Category:In vitro]]
[[Category:DNA]]
[[Category:DNA]]


Latest revision as of 01:19, 18 August 2010

Back to all protocols

Overview

A PCR reaction to generate linearized construction vector backbones for Fusion(Freiburg)-formatted Biobrick assemblies.

The classic assembly protocol digests the target vector (usually pSB1*) in parallel to the digestions of the two Biobrick parts. We prefer to create a stock of target backbone by PCR with a fast high-fidelity polymerase. This way, mutations in the ccdB death cassette of the target vector cannot escape selection.

Materials

Procedure

setup PCR reaction

µl, single reaction 3.5xMaster 10xMaster
H2O 76µl 266 760
5x HF Buffer 20µl 70 200
10mM dNTP 2µl 7 20
rg0301 100 µM 0.5µl 1.75 5
rg0302 100 µM 0.5µl 1.75 5
Phusion 1µl 3.5 10
template DNA 0.1µl -- --

PCR program

  • 30"@98C;
  • 35x (10"@98°C; 15"@68C; 1'30"@72C);
  • 10'@72C;
  • inf. 4C

Post-Processing

  1. add 1µl DpnI, incubate for 1h @ 37°C
    • mix the tube so that the enzyme contacts all surfaces
    • longer (2h) incubation may still reduce background
  2. heat-inactivate 20'@80°C
  3. purify with PCR purification kit
    • elute in water **not** elution buffer
  4. dilute to 28 ng/µl (we assume a 10 % dilution by the following Phosphatase treatment)
  5. proceed with restriction C
    • add 2µl restriction mix C to each 8µl DNA
    • incubate for 3h @ 37°C
    • heat-inactivate 20' @ 80°C
  6. proceed with phosphatase treatment
    • add 10 x antarctic phospatase buffer to 1 x final concentration
    • add 1µl Antarctic Phosphatase
    • incubate 1h @ 37°C; heat-inactivate 5' @ 65°C
  7. verify samples on 1% Agarose gel

Notes

Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!

  1. List troubleshooting tips here.
  2. You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
  3. Anecdotal observations that might be of use to others can also be posted here.

Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.

References

Contact

or instead, discuss this protocol.


Retrieved from "https://openwetware.org/mediawiki/index.php?title=Prbbbb:vector_pcr&oldid=446024"