Prbbbb:vector pcr

Back to all protocols

Overview

A PCR reaction to generate linearized construction vector backbones for Fusion(Freiburg)-formatted Biobrick assemblies.

The classic assembly protocol digests the target vector (usually pSB1*) in parallel to the digestions of the two Biobrick parts. We prefer to create a stock of target backbone by PCR with a fast high-fidelity polymerase. This way, mutations in the ccdB death cassette of the target vector cannot escape selection.

Materials

• 100 ul + PCR tubes
• Phusion HotStart Polymerase 2 U/ul
• Phusion HF Buffer 5x
• dNTP mix 10mM each nucleotide
• ddH2O
• reverse prefix primer rg0301 (CRG) (fusion format, ACCGGTTAATACTAGTAGCGGCC)
• reverse suffix primer rg0302 (CRG) (fusion format, GCCGGCCATCTAGAAGCG)
• vector template DNA
  • pSB1AC3F (CRG) -- BBa_J18901
  • pSB1AK3F (CRG) -- BBa_J18902
  • pSB1AT3F (CRG) -- BBa_J18903
• DpnI restriction enzyme
• Antarctic Phosphatase and 10 x buffer

Procedure

setup PCR reaction

	µl, single reaction	3.5xMaster	10xMaster
H2O	76µl	266	760
5x HF Buffer	20µl	70	200
10mM dNTP	2µl	7	20
rg0301 100 µM	0.5µl	1.75	5
rg0302 100 µM	0.5µl	1.75	5
Phusion	1µl	3.5	10
template DNA	0.1µl	--	--

PCR program

• 30"@98C;
• 35x (10"@98°C; 15"@68C; 1'30"@72C);
• 10'@72C;
• inf. 4C

Post-Processing

1. add 1µl DpnI, incubate for 1h @ 37°C
2. heat-inactivate 20'@80°C
3. proceed with phosphatase treatment
4. purify with PCR purification kit
   • elute in water **not** elution buffer
5. dilute to standard concentration: 25ng/µl

Notes

Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!

1. List troubleshooting tips here.
2. You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
3. Anecdotal observations that might be of use to others can also be posted here.

Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.

Contact

• Raik

or instead, discuss this protocol.