Prbbbb:vector pcr
From OpenWetWare
(Difference between revisions)
Current revision (04:19, 18 August 2010) (view source) (→Procedure) |
|||
| Line 53: | Line 53: | ||
# add 1µl DpnI, incubate for 1h @ 37°C | # add 1µl DpnI, incubate for 1h @ 37°C | ||
| + | #* mix the tube so that the enzyme contacts all surfaces | ||
| + | #* longer (2h) incubation may still reduce background | ||
# heat-inactivate 20'@80°C | # heat-inactivate 20'@80°C | ||
# purify with PCR purification kit | # purify with PCR purification kit | ||
Current revision
Contents |
Overview
A PCR reaction to generate linearized construction vector backbones for Fusion(Freiburg)-formatted Biobrick assemblies.
The classic assembly protocol digests the target vector (usually pSB1*) in parallel to the digestions of the two Biobrick parts. We prefer to create a stock of target backbone by PCR with a fast high-fidelity polymerase. This way, mutations in the ccdB death cassette of the target vector cannot escape selection.
Materials
- 100 ul + PCR tubes
- Phusion HotStart Polymerase 2 U/ul
- Phusion HF Buffer 5x
- dNTP mix 10mM each nucleotide
- ddH2O
- reverse prefix primer rg0301 (CRG) -- -- BBa_J18910 (RFC 25 format, ACCGGTTAATACTAGTAGCGGCC)
- reverse suffix primer rg0302 (CRG) -- BBa_J18911(RFC 25 format, GCCGGCCATCTAGAAGCG)
- vector template DNA
- DpnI restriction enzyme
- Antarctic Phosphatase and 10 x buffer
Procedure
setup PCR reaction
| µl, single reaction | 3.5xMaster | 10xMaster | |
|---|---|---|---|
| H2O | 76µl | 266 | 760 |
| 5x HF Buffer | 20µl | 70 | 200 |
| 10mM dNTP | 2µl | 7 | 20 |
| rg0301 100 µM | 0.5µl | 1.75 | 5 |
| rg0302 100 µM | 0.5µl | 1.75 | 5 |
| Phusion | 1µl | 3.5 | 10 |
| template DNA | 0.1µl | -- | -- |
PCR program
- 30"@98C;
- 35x (10"@98°C; 15"@68C; 1'30"@72C);
- 10'@72C;
- inf. 4C
Post-Processing
- add 1µl DpnI, incubate for 1h @ 37°C
- mix the tube so that the enzyme contacts all surfaces
- longer (2h) incubation may still reduce background
- heat-inactivate 20'@80°C
- purify with PCR purification kit
- elute in water **not** elution buffer
- dilute to 28 ng/µl (we assume a 10 % dilution by the following Phosphatase treatment)
- proceed with restriction C
- add 2µl restriction mix C to each 8µl DNA
- incubate for 3h @ 37°C
- heat-inactivate 20' @ 80°C
- proceed with phosphatase treatment
- add 10 x antarctic phospatase buffer to 1 x final concentration
- add 1µl Antarctic Phosphatase
- incubate 1h @ 37°C; heat-inactivate 5' @ 65°C
- verify samples on 1% Agarose gel
Notes
Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!
- List troubleshooting tips here.
- You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
- Anecdotal observations that might be of use to others can also be posted here.
Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.
References
Contact
or instead, discuss this protocol.


