Primer Tm estimation methods

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(online tool link)
Line 39: Line 39:
* Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
* Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
: Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748
: Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748
: [ online tool using Wallace formula for oligos >13]
: [ online tool] using Wallace formula for oligos >13
* Breslauer et al. 1986, DOI:10.1073/ pnas.83.11.3746
* Breslauer et al. 1986, DOI:10.1073/ pnas.83.11.3746

Revision as of 09:02, 24 September 2009

Comparison of primer Tm estimation methods
example primer Marmur rule Wallace rule Breslauer '86 SantaLucia '98
Tubb5 F: GATCGGTGCTAAGTTCTGGGA 64 54 61.5 53.7
Tubb5 R: AGGGACATACTTGCCACCTGT 64 54 60.8 55.1
  • Marmur formula: Tm = 4 x GC + 2 x AT
not recommended for more than 13nt; assumes 50mM monovalent cations
Marmur J and Doty P (1962) J Mol Biol 5:109-118; PMID 14470099
  • Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748
online tool using Wallace formula for oligos >13
  • Breslauer et al. 1986, DOI:10.1073/ pnas.83.11.3746
Primer3 and Primer3Plus default maintained for backwards compatibility
  • SantaLucia 1998, DOI:10.1073/pnas.95.4.1460
Primer3 recommended setting; also default settings of the NCBI's Primer BLAST
Personal tools