Primer Tm estimation methods

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(links)
(primer length)
Line 3: Line 3:
|-
|-
! example primer
! example primer
 +
! GC+AT=length
! style="background:lightgrey"|Marmur rule
! style="background:lightgrey"|Marmur rule
! style="background:lightgrey"|Wallace rule
! style="background:lightgrey"|Wallace rule
Line 9: Line 10:
|-
|-
| 50/50 mixed: AGAGAGAGAGAGAGAGAGAG
| 50/50 mixed: AGAGAGAGAGAGAGAGAGAG
 +
| 10+10=20
| 60
| 60
| 52
| 52
Line 15: Line 17:
|-
|-
| 50/50 separated: AAAAAAAAAAGGGGGGGGGG
| 50/50 separated: AAAAAAAAAAGGGGGGGGGG
 +
| 10+10=20
| 60
| 60
| 52
| 52
Line 21: Line 24:
|-
|-
| ActB F: TTGCTGACAGGATGCAGAAG
| ActB F: TTGCTGACAGGATGCAGAAG
 +
| 10+10=20
| 60
| 60
| 52
| 52
Line 27: Line 31:
|-
|-
| ActB R: TGATCCACATCTGCTGGAAG  
| ActB R: TGATCCACATCTGCTGGAAG  
 +
| 10+10=20
| 60
| 60
| 52
| 52
Line 33: Line 38:
|-
|-
| Tubb5 F: GATCGGTGCTAAGTTCTGGGA   
| Tubb5 F: GATCGGTGCTAAGTTCTGGGA   
 +
| 11+10=21
| 64
| 64
| 54
| 54
Line 38: Line 44:
| 53.7
| 53.7
|-
|-
 +
| 11+10=21
| Tubb5 R: AGGGACATACTTGCCACCTGT   
| Tubb5 R: AGGGACATACTTGCCACCTGT   
| 64
| 64

Revision as of 03:52, 28 September 2009

Comparison of primer Tm estimation methods
example primer GC+AT=length Marmur rule Wallace rule Breslauer '86 SantaLucia '98
50/50 mixed: AGAGAGAGAGAGAGAGAGAG 10+10=20 60 52 46.3 47.7
50/50 separated: AAAAAAAAAAGGGGGGGGGG 10+10=20 60 52 66.0 52.7
ActB F: TTGCTGACAGGATGCAGAAG 10+10=20 60 52 60.1 52.4
ActB R: TGATCCACATCTGCTGGAAG 10+10=20 60 52 59.8 51.5
Tubb5 F: GATCGGTGCTAAGTTCTGGGA 11+10=21 64 54 61.5 53.7
11+10=21 Tubb5 R: AGGGACATACTTGCCACCTGT 64 54 60.8 55.1
  • Marmur formula: Tm = 4 x GC + 2 x AT
not recommended for more than 13nt; assumes 50mM monovalent cations
Marmur J and Doty P (1962) J Mol Biol 5:109-118; PMID 14470099
  • Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748
online tool using Wallace formula for oligos >13
Primer3 and Primer3Plus default maintained for backwards compatibility
  • SantaLucia 1998, PMID 9465037 thermodynamics & salt correction
Primer3 recommended setting; also default settings of the NCBI's Primer BLAST
Personal tools