Primer Tm estimation methods
From OpenWetWare
(categories) |
Current revision (06:46, 28 September 2009) (view source) |
||
| (18 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
| + | Traditionally, primer Tms have often been calculated using the simplest GCx4+ATx2 rule. This is flawed because the rule was not meant to be used for DNA oligomers longer than 13 nucleotides and because the rule does not take into account the order of nucleotides in the sequence. Due to the ease of use and resulting popularity of Primer3 for locating suitable PCR primer pairs, Breslauer thermodynamic parameters (the default setting of Primer3) are also widely employed to calculate primer Tms. However, the authors of the Primer3 online software tool and the makers of the NCBI's Primer Blast, a similar recent tool, now recommend the use of the improved nearest-neighbour parameter set published by SantaLucia in 1998. The marked differences between these Tm estimation methods are highlighted in the table below. | ||
| + | |||
| + | == Table comparing different Tm estimation methods == | ||
| + | |||
{| {{sorttable}} | {| {{sorttable}} | ||
| - | |||
| - | |||
! example primer | ! example primer | ||
| + | ! GC+AT=length | ||
! style="background:lightgrey"|Marmur rule | ! style="background:lightgrey"|Marmur rule | ||
! style="background:lightgrey"|Wallace rule | ! style="background:lightgrey"|Wallace rule | ||
! style="background:lightgrey"|Breslauer '86 | ! style="background:lightgrey"|Breslauer '86 | ||
! style="background:lightgrey"|SantaLucia '98 | ! style="background:lightgrey"|SantaLucia '98 | ||
| + | |- | ||
| + | | 50/50 mixed: AGAGAGAGAGAGAGAGAGAG | ||
| + | | 10+10=20 | ||
| + | | 60 | ||
| + | | 52 | ||
| + | | 46.3 | ||
| + | | 47.7 | ||
| + | |- | ||
| + | | 50/50 separated: AAAAAAAAAAGGGGGGGGGG | ||
| + | | 10+10=20 | ||
| + | | 60 | ||
| + | | 52 | ||
| + | | 66.0 | ||
| + | | 52.7 | ||
|- | |- | ||
| ActB F: TTGCTGACAGGATGCAGAAG | | ActB F: TTGCTGACAGGATGCAGAAG | ||
| + | | 10+10=20 | ||
| 60 | | 60 | ||
| 52 | | 52 | ||
| 60.1 | | 60.1 | ||
| - | | | + | | 52.4 |
|- | |- | ||
| ActB R: TGATCCACATCTGCTGGAAG | | ActB R: TGATCCACATCTGCTGGAAG | ||
| + | | 10+10=20 | ||
| 60 | | 60 | ||
| 52 | | 52 | ||
| 59.8 | | 59.8 | ||
| - | | | + | | 51.5 |
|- | |- | ||
| Tubb5 F: GATCGGTGCTAAGTTCTGGGA | | Tubb5 F: GATCGGTGCTAAGTTCTGGGA | ||
| + | | 11+10=21 | ||
| 64 | | 64 | ||
| 54 | | 54 | ||
| 61.5 | | 61.5 | ||
| - | | | + | | 53.7 |
|- | |- | ||
| Tubb5 R: AGGGACATACTTGCCACCTGT | | Tubb5 R: AGGGACATACTTGCCACCTGT | ||
| + | | 11+10=21 | ||
| 64 | | 64 | ||
| 54 | | 54 | ||
| 60.8 | | 60.8 | ||
| - | | | + | | 55.1 |
|} | |} | ||
| + | |||
| + | == Conclusions == | ||
| + | |||
| + | * Marmur and Wallace formulae Tm estimation only take into account the number of GC and AT nucleotides. The position of the nucleotides in the primer is not considered (primer 1-4: same Tm; primer 5-6: longer, higher Tm). | ||
| + | * Both Breslauer and SantaLucia nearest-neighbour thermodynamics factor in the nucleotide environment. GC rich islands lead to higher Tm estimates with the upwards trend being much more pronounced when the Breslauer calculations are used (primer 1, 2). | ||
| + | |||
| + | == Melting temperature (Tm) estimation publications == | ||
* Marmur formula: Tm = 4 x GC + 2 x AT | * Marmur formula: Tm = 4 x GC + 2 x AT | ||
| Line 39: | Line 67: | ||
* Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC) | * Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC) | ||
: Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748 | : Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748 | ||
| + | : [http://www.basic.northwestern.edu/biotools/oligocalc.html online tool] using Wallace formula for oligos >13 | ||
| - | * Breslauer et al. 1986, | + | * Breslauer et al. 1986, PMID 3459152 combined with Schildkraut et al. 1965, PMID 5889540 salt correction formulae |
: [http://frodo.wi.mit.edu/primer3/ Primer3] and [http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi Primer3Plus] default maintained for backwards compatibility | : [http://frodo.wi.mit.edu/primer3/ Primer3] and [http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi Primer3Plus] default maintained for backwards compatibility | ||
| - | + | ::<small>'''Breslauer '86 abstract''': We report the complete thermodynamic library of all 10 Watson-Crick DNA nearest-neighbor interactions. We obtained the relevant thermodynamic data from calorimetric studies on 19 DNA oligomers and 9 DNA polymers. We show how these thermodynamic data can be used to calculate the stability and predict the temperature-dependent behavior of any DNA duplex structure from knowledge of its base sequence. We illustrate our method of calculation by using the nearest-neighbor data to predict transition enthalpies and free energies for a series of DNA oligomers. These predicted values are in excellent agreement with the corresponding values determined experimentally. This agreement demonstrates that a <u>DNA duplex structure thermodynamically can be considered to be the sum of its nearest-neighbor interactions</u>. Armed with this knowledge and the nearest-neighbor thermodynamic data reported here, <u>scientists now will be able to predict the stability (delta G degree) and the melting behavior (delta H degree) of any DNA duplex structure from inspection of its primary sequence</u>. This capability should prove valuable in numerous applications, such as predicting the stability of a probe-gene complex; selecting optimal conditions for a hybridization experiment; deciding on the minimum length of a probe; predicting the influence of a specific transversion or transition on the stability of an affected DNA region; and predicting the relative stabilities of local domains within a DNA duplex. | |
| - | : Primer3 recommended setting | + | </small> |
| + | |||
| + | * SantaLucia 1998, PMID 9465037 thermodynamics & salt correction | ||
| + | : Primer3 recommended setting; also default settings of the NCBI's [http://www.ncbi.nlm.nih.gov/tools/primer-blast/ Primer BLAST] | ||
| + | |||
| + | ::<small>'''SantaLucia '98 abstract''': A unified view of polymer, dumbbell, and oligonucleotide nearest-neighbor (NN) thermodynamics is presented. DNA NN DeltaG degrees 37 parameters from <u>seven laboratories</u> are presented in the same format so that careful comparisons can be made. The seven studies used data from <u>natural polymers, synthetic polymers, oligonucleotide dumbbells, and oligonucleotide duplexes to derive NN parameters</u>; used different methods of data analysis; used different salt concentrations; and presented the NN thermodynamics in different formats. As a result of these differences, <u>there has been much confusion regarding the NN thermodynamics of DNA polymers</u> and oligomers. Herein I show that six of the studies are actually in remarkable agreement with one another and explanations are provided in cases where discrepancies remain. Further, a <u>single set of parameters, derived from 108 oligonucleotide duplexes, adequately describes polymer and oligomer thermodynamics</u>. Empirical salt dependencies are also derived for oligonucleotides and polymers.. | ||
| + | </small> | ||
| + | |||
| + | |||
| + | == See also == | ||
| + | * [[Designing primers]] | ||
| + | * [[Griffin:Nested_RT-PCR#Primer_Tm_Values|Griffin lab: Nested RT PCR, section Primer Tm Values]] | ||
| + | * [[Silver:_PCR#A._Primer_design_for_PCR|Silver lab: PCR, section Primer design]] | ||
| + | * [[20.309:Measuring_DNA_Melting_Curves]] | ||
| - | [[Category: | + | [[Category:Bioinformatics]] |
[[Category:DNA]] | [[Category:DNA]] | ||
[[Category:PCR]] | [[Category:PCR]] | ||
Current revision
Traditionally, primer Tms have often been calculated using the simplest GCx4+ATx2 rule. This is flawed because the rule was not meant to be used for DNA oligomers longer than 13 nucleotides and because the rule does not take into account the order of nucleotides in the sequence. Due to the ease of use and resulting popularity of Primer3 for locating suitable PCR primer pairs, Breslauer thermodynamic parameters (the default setting of Primer3) are also widely employed to calculate primer Tms. However, the authors of the Primer3 online software tool and the makers of the NCBI's Primer Blast, a similar recent tool, now recommend the use of the improved nearest-neighbour parameter set published by SantaLucia in 1998. The marked differences between these Tm estimation methods are highlighted in the table below.
Contents |
Table comparing different Tm estimation methods
| example primer | GC+AT=length | Marmur rule | Wallace rule | Breslauer '86 | SantaLucia '98 |
|---|---|---|---|---|---|
| 50/50 mixed: AGAGAGAGAGAGAGAGAGAG | 10+10=20 | 60 | 52 | 46.3 | 47.7 |
| 50/50 separated: AAAAAAAAAAGGGGGGGGGG | 10+10=20 | 60 | 52 | 66.0 | 52.7 |
| ActB F: TTGCTGACAGGATGCAGAAG | 10+10=20 | 60 | 52 | 60.1 | 52.4 |
| ActB R: TGATCCACATCTGCTGGAAG | 10+10=20 | 60 | 52 | 59.8 | 51.5 |
| Tubb5 F: GATCGGTGCTAAGTTCTGGGA | 11+10=21 | 64 | 54 | 61.5 | 53.7 |
| Tubb5 R: AGGGACATACTTGCCACCTGT | 11+10=21 | 64 | 54 | 60.8 | 55.1 |
Conclusions
- Marmur and Wallace formulae Tm estimation only take into account the number of GC and AT nucleotides. The position of the nucleotides in the primer is not considered (primer 1-4: same Tm; primer 5-6: longer, higher Tm).
- Both Breslauer and SantaLucia nearest-neighbour thermodynamics factor in the nucleotide environment. GC rich islands lead to higher Tm estimates with the upwards trend being much more pronounced when the Breslauer calculations are used (primer 1, 2).
Melting temperature (Tm) estimation publications
- Marmur formula: Tm = 4 x GC + 2 x AT
- not recommended for more than 13nt; assumes 50mM monovalent cations
- Marmur J and Doty P (1962) J Mol Biol 5:109-118; PMID 14470099
- Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
- Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748
- online tool using Wallace formula for oligos >13
- Breslauer et al. 1986, PMID 3459152 combined with Schildkraut et al. 1965, PMID 5889540 salt correction formulae
- Primer3 and Primer3Plus default maintained for backwards compatibility
- Breslauer '86 abstract: We report the complete thermodynamic library of all 10 Watson-Crick DNA nearest-neighbor interactions. We obtained the relevant thermodynamic data from calorimetric studies on 19 DNA oligomers and 9 DNA polymers. We show how these thermodynamic data can be used to calculate the stability and predict the temperature-dependent behavior of any DNA duplex structure from knowledge of its base sequence. We illustrate our method of calculation by using the nearest-neighbor data to predict transition enthalpies and free energies for a series of DNA oligomers. These predicted values are in excellent agreement with the corresponding values determined experimentally. This agreement demonstrates that a DNA duplex structure thermodynamically can be considered to be the sum of its nearest-neighbor interactions. Armed with this knowledge and the nearest-neighbor thermodynamic data reported here, scientists now will be able to predict the stability (delta G degree) and the melting behavior (delta H degree) of any DNA duplex structure from inspection of its primary sequence. This capability should prove valuable in numerous applications, such as predicting the stability of a probe-gene complex; selecting optimal conditions for a hybridization experiment; deciding on the minimum length of a probe; predicting the influence of a specific transversion or transition on the stability of an affected DNA region; and predicting the relative stabilities of local domains within a DNA duplex.
- SantaLucia 1998, PMID 9465037 thermodynamics & salt correction
- Primer3 recommended setting; also default settings of the NCBI's Primer BLAST
- SantaLucia '98 abstract: A unified view of polymer, dumbbell, and oligonucleotide nearest-neighbor (NN) thermodynamics is presented. DNA NN DeltaG degrees 37 parameters from seven laboratories are presented in the same format so that careful comparisons can be made. The seven studies used data from natural polymers, synthetic polymers, oligonucleotide dumbbells, and oligonucleotide duplexes to derive NN parameters; used different methods of data analysis; used different salt concentrations; and presented the NN thermodynamics in different formats. As a result of these differences, there has been much confusion regarding the NN thermodynamics of DNA polymers and oligomers. Herein I show that six of the studies are actually in remarkable agreement with one another and explanations are provided in cases where discrepancies remain. Further, a single set of parameters, derived from 108 oligonucleotide duplexes, adequately describes polymer and oligomer thermodynamics. Empirical salt dependencies are also derived for oligonucleotides and polymers..


