Primer Tm estimation methods: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(categories) |
No edit summary |
||
Line 47: | Line 47: | ||
[[Category: | [[Category:Bioinformatics]] | ||
[[Category:DNA]] | [[Category:DNA]] | ||
[[Category:PCR]] | [[Category:PCR]] |
Revision as of 06:50, 24 September 2009
example primer | Marmur rule | Wallace rule | Breslauer '86 | SantaLucia '98 |
---|---|---|---|---|
ActB F: TTGCTGACAGGATGCAGAAG | 60 | 52 | 60.1 | 45.8 |
ActB R: TGATCCACATCTGCTGGAAG | 60 | 52 | 59.8 | 45.0 |
Tubb5 F: GATCGGTGCTAAGTTCTGGGA | 64 | 54 | 61.5 | 47.3 |
Tubb5 R: AGGGACATACTTGCCACCTGT | 64 | 54 | 60.8 | 49.2 |
- Marmur formula: Tm = 4 x GC + 2 x AT
- not recommended for more than 13nt; assumes 50mM monovalent cations
- Marmur J and Doty P (1962) J Mol Biol 5:109-118; PMID 14470099
- Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
- Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748
- Breslauer et al. 1986, DOI:10.1073/ pnas.83.11.3746
- Primer3 and Primer3Plus default maintained for backwards compatibility
- SantaLucia 1998, DOI:10.1073/pnas.95.4.1460
- Primer3 recommended setting