Primer Tm estimation methods

From OpenWetWare

Revision as of 04:52, 28 September 2009 by Jakob Suckale (Talk | contribs)
Jump to: navigation, search
Comparison of primer Tm estimation methods
example primer GC+AT=length Marmur rule Wallace rule Breslauer '86 SantaLucia '98
50/50 mixed: AGAGAGAGAGAGAGAGAGAG 10+10=20 60 52 46.3 47.7
50/50 separated: AAAAAAAAAAGGGGGGGGGG 10+10=20 60 52 66.0 52.7
ActB F: TTGCTGACAGGATGCAGAAG 10+10=20 60 52 60.1 52.4
ActB R: TGATCCACATCTGCTGGAAG 10+10=20 60 52 59.8 51.5
Tubb5 F: GATCGGTGCTAAGTTCTGGGA 11+10=21 64 54 61.5 53.7
11+10=21 Tubb5 R: AGGGACATACTTGCCACCTGT 64 54 60.8 55.1
  • Marmur formula: Tm = 4 x GC + 2 x AT
not recommended for more than 13nt; assumes 50mM monovalent cations
Marmur J and Doty P (1962) J Mol Biol 5:109-118; PMID 14470099
  • Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748
online tool using Wallace formula for oligos >13
Primer3 and Primer3Plus default maintained for backwards compatibility
  • SantaLucia 1998, PMID 9465037 thermodynamics & salt correction
Primer3 recommended setting; also default settings of the NCBI's Primer BLAST
Personal tools