Primers for aiiA gene from Dr Fray.doc‎

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
==aiiA gene from Dr Fray==
==aiiA gene from Dr Fray==
-
  ATGACAGTAAAGAAGCTTTATTTCGTACCAGCAGGTCGTTGTATGTTGGATCATTCGTCTGTTAACAGTA 70
+
  ATGACAGTAAAGAAGCTTTATTTCGTACCAGCAGGTCGTTGTATGTTGGATCATTCGTCTGTTAACAGTA  
-
  CATTAACACGAGGGGAATTATTAGACTTACCGGTTTGGTGTTATCTTTTGGAGACTGAAGAAGGACCTAT 140
+
  CATTAACACGAGGGGAATTATTAGACTTACCGGTTTGGTGTTATCTTTTGGAGACTGAAGAAGGACCTAT  
-
  TTTAGTAGATACAGGTATGCCAGAAAGTGCGGTTAATAATGAAGGCCTTTTTAACGGTACATTTGTTGAA 210
+
  TTTAGTAGATACAGGTATGCCAGAAAGTGCGGTTAATAATGAAGGCCTTTTTAACGGTACATTTGTTGAA  
-
GGACATATTTTACCAAAAATGACTGAAGAAGATAGAATCGTGAATATTTTAAAACGCGTTGGTTATGAGC 280
+
  CGGAAGACCTTCTTTATATTATTAGTTCTCACTTACATTTTGATCATGCAGGAGGAAATGGTGCTTTTAC  
-
  CGGAAGACCTTCTTTATATTATTAGTTCTCACTTACATTTTGATCATGCAGGAGGAAATGGTGCTTTTAC 350
+
  AAATACACCGATTATTGTGCAGCGTGCTGAATACGAGGCGGCACAACATAGTGAAGAATATATGAAAGAA  
-
  AAATACACCGATTATTGTGCAGCGTGCTGAATACGAGGCGGCACAACATAGTGAAGAATATATGAAAGAA 420
+
  TGTATATTGCCGAATTTGAAATACAAGATCATTGAAGGGGATTATGAAGTCGTACCAGGAGTTCAATTAT  
-
  TGTATATTGCCGAATTTGAAATACAAGATCATTGAAGGGGATTATGAAGTCGTACCAGGAGTTCAATTAT 490
+
  TGTATACACCAGGACATACTCCGGGGCATCAGTCGCTATTAATTGAGACAGAAAAATCCGGTCCTGTGTT  
-
  TGTATACACCAGGACATACTCCGGGGCATCAGTCGCTATTAATTGAGACAGAAAAATCCGGTCCTGTGTT 560
+
  ATTAACGATTGATGCATCTTATACGAAAGAAAATTTTGAAGATGAAGTGCCGTTCGCTGGATTTGATTCG  
-
  ATTAACGATTGATGCATCTTATACGAAAGAAAATTTTGAAGATGAAGTGCCGTTCGCTGGATTTGATTCG 630
+
  GAATTAGCTTTATCTTCAATTAAACGTTTAAAAGAAGTTGTTAGGAAAGAGAACCCAATTGTTTTCTTTG  
-
  GAATTAGCTTTATCTTCAATTAAACGTTTAAAAGAAGTTGTTAGGAAAGAGAACCCAATTGTTTTCTTTG 700
+
  GACATGATATAGAGCAGGAAAAGAGTTGTAAAGTGTTCCCTGAATATATATAG
  GACATGATATAGAGCAGGAAAAGAGTTGTAAAGTGTTCCCTGAATATATATAG
-
===Components we want to add===
+
===Components===
-
'''Degredation Tag + Stop codons'''
+
'''Degradation Tag + Stop codons'''
-
  Gctgcaaacgacgaaaactacgctttagtagcttaataa
+
  GCTGCAAACGACGAAAACTACGCTTTAGTAGCTTAATAA
'''Epitope tag + start codon'''
'''Epitope tag + start codon'''
-
  ATGgattataaagatgatgatgataaaggt
+
  ATGGATTATAAAGATGATGATGATAAAGGT
-
 
+
-
'''Restriction sites'''
+
-
 
+
-
*Start
+
-
- gaattcgcggccgcatctagag
+
-
EcoRI XbaI
+
-
 
+
-
*End
+
-
- tactagtagcggccgctgcag
+
-
    SpeI   PstI
+
'''Desired Sequence'''
'''Desired Sequence'''

Revision as of 11:17, 28 October 2006

aiiA gene from Dr Fray

ATGACAGTAAAGAAGCTTTATTTCGTACCAGCAGGTCGTTGTATGTTGGATCATTCGTCTGTTAACAGTA 
CATTAACACGAGGGGAATTATTAGACTTACCGGTTTGGTGTTATCTTTTGGAGACTGAAGAAGGACCTAT 
TTTAGTAGATACAGGTATGCCAGAAAGTGCGGTTAATAATGAAGGCCTTTTTAACGGTACATTTGTTGAA 
CGGAAGACCTTCTTTATATTATTAGTTCTCACTTACATTTTGATCATGCAGGAGGAAATGGTGCTTTTAC 
AAATACACCGATTATTGTGCAGCGTGCTGAATACGAGGCGGCACAACATAGTGAAGAATATATGAAAGAA 
TGTATATTGCCGAATTTGAAATACAAGATCATTGAAGGGGATTATGAAGTCGTACCAGGAGTTCAATTAT 
TGTATACACCAGGACATACTCCGGGGCATCAGTCGCTATTAATTGAGACAGAAAAATCCGGTCCTGTGTT 
ATTAACGATTGATGCATCTTATACGAAAGAAAATTTTGAAGATGAAGTGCCGTTCGCTGGATTTGATTCG 
GAATTAGCTTTATCTTCAATTAAACGTTTAAAAGAAGTTGTTAGGAAAGAGAACCCAATTGTTTTCTTTG 
GACATGATATAGAGCAGGAAAAGAGTTGTAAAGTGTTCCCTGAATATATATAG

Components

Degradation Tag + Stop codons

GCTGCAAACGACGAAAACTACGCTTTAGTAGCTTAATAA

Epitope tag + start codon

ATGGATTATAAAGATGATGATGATAAAGGT

Desired Sequence

We are cutting with spe1 and ecoR1 so the 3’end can have the Pst1 restrection site removed to shorten the primers

Restriction Sites-Epitope tag-gene Degredation tag-Restriction Sites

GAATTCGCGGCCGCATCTAGAGATGGATTATAAAGATGATGATGATAAAGGTATGACAGTAAAGAAGCTT 70
TATTTCGTACCAGCAGGTCGTTGTATGTTGGATCATTCGTCTGTTAACAGTACATTAACACGAGGGGAAT 140
TATTAGACTTACCGGTTTGGTGTTATCTTTTGGAGACTGAAGAAGGACCTATTTTAGTAGATACAGGTAT 210
GCCAGAAAGTGCGGTTAATAATGAAGGCCTTTTTAACGGTACATTTGTTGAAGGACATATTTTACCAAAA 280
ATGACTGAAGAAGATAGAATCGTGAATATTTTAAAACGCGTTGGTTATGAGCCGGAAGACCTTCTTTATA 350
TTATTAGTTCTCACTTACATTTTGATCATGCAGGAGGAAATGGTGCTTTTACAAATACACCGATTATTGT 420
GCAGCGTGCTGAATACGAGGCGGCACAACATAGTGAAGAATATATGAAAGAATGTATATTGCCGAATTTG 490
AAATACAAGATCATTGAAGGGGATTATGAAGTCGTACCAGGAGTTCAATTATTGTATACACCAGGACATA 560
CTCCGGGGCATCAGTCGCTATTAATTGAGACAGAAAAATCCGGTCCTGTGTTATTAACGATTGATGCATC 630
TTATACGAAAGAAAATTTTGAAGATGAAGTGCCGTTCGCTGGATTTGATTCGGAATTAGCTTTATCTTCA 700
ATTAAACGTTTAAAAGAAGTTGTTAGGAAAGAGAACCCAATTGTTTTCTTTGGACATGATATAGAGCAGG 770
AAAAGAGTTGTAAAGTGTTCCCTGAATATATAGCTGCAAACGACGAAAACTACGCTTTAGTAGCTTAATA 840
ATACTAGTA

Primers

  • 5’end = same as gene.
gaattcgcggccgcatctagagATGgattataaagatgatgatgataaaggtATGACAGTAAAGAAGCTTTATTTCG
  • 3’end = reverse and complementary to gene
TACTAGTATTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCTATATATTCAGGGAACACTTTAC
Personal tools