Primers for aiiA gene from Dr Fray.doc‎

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (11:11, 28 October 2006) (view source)
 
Line 26: Line 26:
We are cutting with spe1 and ecoR1 so the 3’end can have the Pst1 restrection site removed to shorten the primers
We are cutting with spe1 and ecoR1 so the 3’end can have the Pst1 restrection site removed to shorten the primers
-
<font color = yellow>Restriction Sites-</font colour><font color = red>Epitope tag</font color = red>-gene <font color = red>Degradation tag</font color = red>-Restriction Sites
+
<font color = orange>Restriction Sites-</font colour><font color = red>Epitope tag</font color = red>-gene <font color = red>Degradation tag</font color = red>-Restriction Sites
  '''<font color = orange>GAATTCGCGGCCGCATCTAGAG</font colour><font color = red>ATGGATTATAAAGATGATGATGATAAAGGT</font color = red>ATGACAGTAAAGAAGCTT 70
  '''<font color = orange>GAATTCGCGGCCGCATCTAGAG</font colour><font color = red>ATGGATTATAAAGATGATGATGATAAAGGT</font color = red>ATGACAGTAAAGAAGCTT 70

Current revision

aiiA gene from Dr Fray

ATGACAGTAAAGAAGCTTTATTTCGTACCAGCAGGTCGTTGTATGTTGGATCATTCGTCTGTTAACAGTA 
CATTAACACGAGGGGAATTATTAGACTTACCGGTTTGGTGTTATCTTTTGGAGACTGAAGAAGGACCTAT 
TTTAGTAGATACAGGTATGCCAGAAAGTGCGGTTAATAATGAAGGCCTTTTTAACGGTACATTTGTTGAA 
CGGAAGACCTTCTTTATATTATTAGTTCTCACTTACATTTTGATCATGCAGGAGGAAATGGTGCTTTTAC 
AAATACACCGATTATTGTGCAGCGTGCTGAATACGAGGCGGCACAACATAGTGAAGAATATATGAAAGAA 
TGTATATTGCCGAATTTGAAATACAAGATCATTGAAGGGGATTATGAAGTCGTACCAGGAGTTCAATTAT 
TGTATACACCAGGACATACTCCGGGGCATCAGTCGCTATTAATTGAGACAGAAAAATCCGGTCCTGTGTT 
ATTAACGATTGATGCATCTTATACGAAAGAAAATTTTGAAGATGAAGTGCCGTTCGCTGGATTTGATTCG 
GAATTAGCTTTATCTTCAATTAAACGTTTAAAAGAAGTTGTTAGGAAAGAGAACCCAATTGTTTTCTTTG 
GACATGATATAGAGCAGGAAAAGAGTTGTAAAGTGTTCCCTGAATATATATAG

Components

Degradation Tag + Stop codons

GCTGCAAACGACGAAAACTACGCTTTAGTAGCTTAATAA

Epitope tag + start codon

ATGGATTATAAAGATGATGATGATAAAGGT

Desired Sequence

We are cutting with spe1 and ecoR1 so the 3’end can have the Pst1 restrection site removed to shorten the primers

Restriction Sites-Epitope tag-gene Degradation tag-Restriction Sites

GAATTCGCGGCCGCATCTAGAGATGGATTATAAAGATGATGATGATAAAGGTATGACAGTAAAGAAGCTT 70
TATTTCGTACCAGCAGGTCGTTGTATGTTGGATCATTCGTCTGTTAACAGTACATTAACACGAGGGGAAT 140
TATTAGACTTACCGGTTTGGTGTTATCTTTTGGAGACTGAAGAAGGACCTATTTTAGTAGATACAGGTAT 210
GCCAGAAAGTGCGGTTAATAATGAAGGCCTTTTTAACGGTACATTTGTTGAAGGACATATTTTACCAAAA 280
ATGACTGAAGAAGATAGAATCGTGAATATTTTAAAACGCGTTGGTTATGAGCCGGAAGACCTTCTTTATA 350
TTATTAGTTCTCACTTACATTTTGATCATGCAGGAGGAAATGGTGCTTTTACAAATACACCGATTATTGT 420
GCAGCGTGCTGAATACGAGGCGGCACAACATAGTGAAGAATATATGAAAGAATGTATATTGCCGAATTTG 490
AAATACAAGATCATTGAAGGGGATTATGAAGTCGTACCAGGAGTTCAATTATTGTATACACCAGGACATA 560
CTCCGGGGCATCAGTCGCTATTAATTGAGACAGAAAAATCCGGTCCTGTGTTATTAACGATTGATGCATC 630
TTATACGAAAGAAAATTTTGAAGATGAAGTGCCGTTCGCTGGATTTGATTCGGAATTAGCTTTATCTTCA 700
ATTAAACGTTTAAAAGAAGTTGTTAGGAAAGAGAACCCAATTGTTTTCTTTGGACATGATATAGAGCAGG 770
AAAAGAGTTGTAAAGTGTTCCCTGAATATATAGCTGCAAACGACGAAAACTACGCTTTAGTAGCTTAATA 840
ATACTAGTA

Primers

  • 5’end = same as gene.
gaattcgcggccgcatctagagATGgattataaagatgatgatgataaaggtATGACAGTAAAGAAGCTTTATTTCG
  • 3’end = reverse and complementary to gene
TACTAGTATTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCTATATATTCAGGGAACACTTTAC
Personal tools