Protocol to Genotype ColI (2.3)-tTA Mice: R. 20080528
Overview
List of reagents is not yet complete
Procedure
Note: DNA Extraction Method and PCR Reaction Mix of Sigma Aldrich as well as Protocol are being use for genotyping. Product Code XNAT- 1KT. For detailed Technical Bulletin go to: http://www.sigma-aldrich.com
Primers: ECH048 GTCGTAATAATGGCGGCATA 3' tTA ECH049 CCAGCCACACTCCAGTGA 5' 2.3 alpha Col
PCR product: 960 bp
Reagents Needed (Provided in Sigma Kit) For Tail Digest:
Extraction Solution Product Code E7526 Tissue Prep Solution Product Code T3073 Neutralization Solution B Prod. Code N3910 For PCR Reaction:
REDExtract-N-Amp PCR reaction Mix Product Code R4775 Procedure:
For DNA Extraction from tail tips:
1. Mix 50ul of Extraction Solution and 12.5ul of tissue prep Solution Note: If several reactions will be done, a master mix of extract solution and tissue prep may be. 2. Add the previously cut 0.5 to 1 cm. Mouse tail tip to the solution. 3. Incubate sample at room temperature for 10 min. 4. Incubate sample at 95 C for 3 min. 5. Add 50ul of Neutralization solution B to sample and mix by vortexing. 6. Store the neutralized tissue extract at 4 C or use immediately in PCR.
PCR amplification
1. Add the following reagents to a PCR tube:
Water (DI, or PCR grade) 5.2 ul RedExtract-N-Amp PCR mix 10.0 ul. Forward Primer 0.4 ul. (25 uM) Reverse Primer 0.4 ul (25 uM) Tissue extract 4.0 ul.
Total volume 20.0 ul.
2. Mix all reagents gently.
3. Perform PCR in the following conditions: (program EDColI)
1. 94 C for 5:00 2. 94 C for 0:45 3. 65 C for 1:00 4. 72 C for 1:30 5. Go to 2, 14 times 6. 94 C for 0:45 7. 58 C for 1:00 8. 72 C for 1:30 9. Go to #6 19 times 10. 72 C for 15:00 11. 15 C for ever 12. End
4. Analyze Product on a 2% agarose gel. Note: all 20ul of product may be loaded directly to gel, no need to use a separate loading buffer.
Note: Now using half the amount of Tail Digest reagents (to save reagents). It used to be 100ul for Extract sol, and 25ul of Tissue prep. Results have proven to be as effective.
Notes
No further notes are available at this time.
References
Relevant papers and books
If this protocol has papers or books associated with it, list those references here. Below is an example for formatting purposes. See the OpenWetWare:Biblio page for more information.
- Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 |
- JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 |
- ISBN:0879697164
Contact
- Who has experience with this protocol?
or instead, discuss this protocol.