Protocol to Genotype NKX2-5 BAC Mice: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(5 intermediate revisions by the same user not shown)
Line 1: Line 1:
==Overview==
==Overview==


Replace this sentence with a brief description of the protocol and its goal.
List of reagents is not yet complete
 
==Materials==
List reagents, supplies and equipment necessary to perform the protocol here.  For those materials which have their own OWW pages, link to that page.  Alternatively, links to the suppliers' page on that material are also appropriate.
 
*supply 1 (i.e. tubes of a certain size? spreaders?)
*reagent 1
*X μL reagent 2
**component A (reagent 2 is made up of multiple components)
**component B
*equipment 1
*equipment 2


==Procedure==
==Procedure==




Note: DNA Extraction Method and PCR Reaction Mix of Sigma Aldrich as well as Protocol are being use for genotyping. Product Code XNAT- 1KT. For detailed Technical Bulletin go to sigma-aldrich.com.
'''Note:''' DNA Extraction Method and PCR Reaction Mix of Sigma Aldrich as well as Protocol are being use for genotyping. Product Code XNAT- 1KT. For detailed Technical Bulletin go to sigma-aldrich.com.


Primers:
'''Primers:'''


NKX2.5-R GTTTCTTGGGGACGAAAG NKX2.5-R Screen
[[Image:primers.tiff]]
NKX2.5F 9232 GACGTGACCCTGTTCATCAG CHORI 9232


PCR product: 367 bp.
PCR product: 367 bp.
Reagents Needed (Provided in Sigma Kit)
 
'''Reagents Needed (Provided in Sigma Kit)'''


For Tail Digest:
For Tail Digest:
Line 36: Line 25:


REDExtract-N-Amp PCR reaction Mix Product Code R4775
REDExtract-N-Amp PCR reaction Mix Product Code R4775
Procedure:


For DNA Extraction from tail tips:
'''Procedure:'''
 
'''For DNA Extraction from tail tips:'''


1. Mix 50ul of Extraction Solution and 12.5ul of tissue prep solution. Note: If several reactions will be done, a master mix of extract solution and tissue prep may be.
1. Mix 50ul of Extraction Solution and 12.5ul of tissue prep solution. Note: If several reactions will be done, a master mix of extract solution and tissue prep may be.
Line 48: Line 38:




PCR amplification
'''PCR amplification'''


1. Add the following reagents to a PCR tube:
1. Add the following reagents to a PCR tube:
Line 76: Line 66:
4. Analyze product on a 2% agarose gel. Note: all 20ul of product may be loaded directly to gel, no need to use a separate loading buffer.
4. Analyze product on a 2% agarose gel. Note: all 20ul of product may be loaded directly to gel, no need to use a separate loading buffer.


Note:
'''Note:'''
Now using half the amount of Tail Digest reagents (to save reagents). It used to be 100ul for Extract solution, and 25ul of Tissue prep. Results have proven to be as effective.
Now using half the amount of Tail Digest reagents (to save reagents). It used to be 100ul for Extract solution, and 25ul of Tissue prep. Results have proven to be as effective.
==Notes==
==Notes==
Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!
No further notes are available at this time.
#List troubleshooting tips here. 
#You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
#Anecdotal observations that might be of use to others can also be posted here. 
 
Please sign your name to your note by adding <font face="courier"><nowiki>'''*~~~~''':</nowiki></font> to the beginning of your tip.


==References==
==References==
'''Relevant papers and books'''
'''Relevant papers and books'''


If this protocol has papers or books associated with it, list those references here. Below is an example for formatting purposes. See the [[OpenWetWare:Biblio]] page for more information.  
No further references are available at this time.
<biblio>
#Goldbeter-PNAS-1981 pmid=6947258
#Jacob-JMB-1961 pmid=13718526
#Ptashne-Genetic-Switch isbn=0879697164
</biblio>


==Contact==
==Contact==

Latest revision as of 16:06, 24 June 2009

Overview

List of reagents is not yet complete

Procedure

Note: DNA Extraction Method and PCR Reaction Mix of Sigma Aldrich as well as Protocol are being use for genotyping. Product Code XNAT- 1KT. For detailed Technical Bulletin go to sigma-aldrich.com.

Primers:

PCR product: 367 bp.

Reagents Needed (Provided in Sigma Kit)

For Tail Digest:

Extraction Solution Product Code E7526 Tissue Prep Solution Product Code T3073 Neutralization Solution B Product Code N3910

For PCR Reaction:

REDExtract-N-Amp PCR reaction Mix Product Code R4775

Procedure:

For DNA Extraction from tail tips:

1. Mix 50ul of Extraction Solution and 12.5ul of tissue prep solution. Note: If several reactions will be done, a master mix of extract solution and tissue prep may be. 2. Add the previously cut 0.5 to 1 cm mouse tail tip to the solution. 3. Incubate sample at room temperature for 10 min. 4. Incubate sample at 95 C for 3 min. 5. Add 50ul of Neutralization solution B to each sample and mix by vortexing. 6. Store the neutralized tissue extract at 4 C or use immediately in PCR.


PCR amplification

1. Add the following reagents to a PCR tube:

Water (DI, or PCR grade) 5.2 ul RedExtract-N-Amp PCR mix 10.0 ul. Forward Primer 0.4 ul. (25 uM) Reverse Primer 0.4 ul (25 uM) Tissue extract 4.0 ul

Total volume 20.0 ul


2. Mix all reagents gently.

3. Perform PCR in the following conditions: (program ED004)

1. 94 C for 5:00 2. 94 C for 1:00 3. 56 C for 1:00 4. 75 C for 1:00 5. Go to 2, 34 times 6. 72 C for 15:00 7. 15 C for ever 8. End

4. Analyze product on a 2% agarose gel. Note: all 20ul of product may be loaded directly to gel, no need to use a separate loading buffer.

Note: Now using half the amount of Tail Digest reagents (to save reagents). It used to be 100ul for Extract solution, and 25ul of Tissue prep. Results have proven to be as effective.

Notes

No further notes are available at this time.

References

Relevant papers and books

No further references are available at this time.

Contact

  • Who has experience with this protocol?

or instead, discuss this protocol.