Protocol to Genotype NKX2-5 BAC Mice

Overview

Replace this sentence with a brief description of the protocol and its goal.

Materials

List reagents, supplies and equipment necessary to perform the protocol here. For those materials which have their own OWW pages, link to that page. Alternatively, links to the suppliers' page on that material are also appropriate.

• supply 1 (i.e. tubes of a certain size? spreaders?)
• reagent 1
• X μL reagent 2
  • component A (reagent 2 is made up of multiple components)
  • component B
• equipment 1
• equipment 2

Procedure

Note: DNA Extraction Method and PCR Reaction Mix of Sigma Aldrich as well as Protocol are being use for genotyping. Product Code XNAT- 1KT. For detailed Technical Bulletin go to sigma-aldrich.com.

Primers:

NKX2.5-R GTTTCTTGGGGACGAAAG NKX2.5-R Screen NKX2.5F 9232 GACGTGACCCTGTTCATCAG CHORI 9232

PCR product: 367 bp. Reagents Needed (Provided in Sigma Kit)

For Tail Digest:

Extraction Solution Product Code E7526 Tissue Prep Solution Product Code T3073 Neutralization Solution B Product Code N3910

For PCR Reaction:

REDExtract-N-Amp PCR reaction Mix Product Code R4775 Procedure:

For DNA Extraction from tail tips:

1. Mix 50ul of Extraction Solution and 12.5ul of tissue prep solution. Note: If several reactions will be done, a master mix of extract solution and tissue prep may be. 2. Add the previously cut 0.5 to 1 cm mouse tail tip to the solution. 3. Incubate sample at room temperature for 10 min. 4. Incubate sample at 95 C for 3 min. 5. Add 50ul of Neutralization solution B to each sample and mix by vortexing. 6. Store the neutralized tissue extract at 4 C or use immediately in PCR.

PCR amplification

1. Add the following reagents to a PCR tube:

Water (DI, or PCR grade) 5.2 ul RedExtract-N-Amp PCR mix 10.0 ul. Forward Primer 0.4 ul. (25 uM) Reverse Primer 0.4 ul (25 uM) Tissue extract 4.0 ul

Total volume 20.0 ul

2. Mix all reagents gently.

3. Perform PCR in the following conditions: (program ED004)

1. 94 C for 5:00 2. 94 C for 1:00 3. 56 C for 1:00 4. 75 C for 1:00 5. Go to 2, 34 times 6. 72 C for 15:00 7. 15 C for ever 8. End

4. Analyze product on a 2% agarose gel. Note: all 20ul of product may be loaded directly to gel, no need to use a separate loading buffer.

Note: Now using half the amount of Tail Digest reagents (to save reagents). It used to be 100ul for Extract solution, and 25ul of Tissue prep. Results have proven to be as effective.

Notes

Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!

1. List troubleshooting tips here.
2. You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
3. Anecdotal observations that might be of use to others can also be posted here.

Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.

References

Relevant papers and books

If this protocol has papers or books associated with it, list those references here. Below is an example for formatting purposes. See the OpenWetWare:Biblio page for more information.

1. Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 |
2. JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 |
3. ISBN:0879697164

Contact

• Who has experience with this protocol?

or instead, discuss this protocol.