R02-ORF

From OpenWetWare

Revision as of 14:55, 25 June 2009 by Elana Urbansky (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Ro2-ORF

This is the RASSL Ro2, derived from the hKOR-FLAG/HA. All the sequence is identical to hKOR-FLAG/HA except for the mutations in extracellular loops 2 and 3 (making it a RASSL) and the removal of the C-terminal HA tag.

Just like hKOR-FLAG/HA: the 5 and 3 non-coding sequences have been removed, an N-terminal NLS from prolactin added, and the N-terminal FLAGepitope tag added. The NLS is reported to increase surface expression of receptors and is cleaved off leaving the free FLAG epitope that is recognizedby the M1 antibody (available from Kodak-IBI). The NLS construct was a gift from Shaun Coughlin (Ishii, K, et. al., JBC, 1993, 268, 9780-9786). All portions of this construct that underwent PCR have been sequenced and are identical to the original human cDNA clone kindly provide by Dr.Lee-YuanLiu-Chen (Zhu et. al., Life Sciences, 1995, Vol. 56, No 9, pg. 201-207).

The 5 unique cloning sites are Kpn I and Xho I.

The 3 unique cloning site is Xba I, which is blocked by Dam methylation (because of a poor choice of the preceding sequence in the stop codon).Therefore you will have to grow the plasmid in Dam(-) cells if you want to use this site.

For the full map of how that is placed into pcDNA3 see: hKOR-FLAG/HA-pcDNA3

The mutations in Ro2 that render it relatively impervious (2000 x decrease) to activation by endogenous opioids are noted in Coward et al PNAS, 1998,95 pg. 352-357. All the sequence which is not hKOR derived is noted in lowercase. The Conklin Lab reference number for this plasmid is pC157.

Sequence of Ro2-ORF:

atggacagcaaaggttcgtcgcagaaagggtcccgcctgctcctgctgctggtggtgtca aatctactcttgtgccagggtgtggtctccgattacaaagatgatgatgatgtcGACTCC CCGATCCAGATCTTCCGCGGGGAGCCGGGCCCTACCTGCGCCCCGAGCGCCTGCCTGCCC CCCAACAGCAGCGCCTGGTTTCCCGGCTGGGCCGAGCCCGACAGCAACGGCAGCGCCGGC TCGGAGGACGCGCAGCTGGAGCCCGCGCACATCTCCCCGGCCATCCCGGTCATCATCACG GCGGTCTACTCCGTAGTGTTCGTCGTGGGCTTGGTGGGCAACTCGCTGGTCATGTTCGTG ATCATCCGATACACAAAGATGAAGACAGCAACCAACATTTACATATTTAACCTGGCTTTG GCAGATGCTTTAGTTACTACAACCATGCCCTTTCAGAGTACGGTCTACTTGATgaattct tggccttttggagatgttctgtgcaagattgtcatttccattgactactacaacatgttt accagcatattcaccttgaccatgatgagtgtggaccgttacattgccgtgtgccaccct gtgaaagctttggatttccgaacacctttgaaagcaaagatcatcaacatctgcatttgg ctactggcatcatctgttggtatatcagcgatagtccttggggtgacccaaccccgggat ggagcagtggtatgcacgctccagttccccagccccagctggtactgggacactgtgacc aagatctGCGTCTTCATCTTTGCCTTCGTGATCCCTGTCCTCATCATCATCGTCTGCTAC ACCCTGATGATCCTGCGTCTCAAGAGCGTCCGGCTCCTTTCTGGCTCCCGAGAGAAAGAT CGCAACCTGCGTAGGATCACCAGACTGGTCCTGGTGGTGGTGGCAGTCTTCGTCGTCTGC TGGACTCCCATTCACATATTCATCCTaGTtcAGGCTCTGGGGAGCACCTCCCACAGCACA GCTGCTCTCTCCAGCTATTACTTCTGCATCGCCTTAGGCTATACCAACAGTAGCCTGAAT CCCATTCTCTACGCCTTTCTTGATGAAAACTTCAAGCGGTGTTTCCGGGACTTCTGCTTT CCACTGAAGATGAGGATGGAGCGGCAGAGCACTAGCAGAGTCCGAAATACAGTTCAGGAT CCTGCTTACCTGAGGGACATCGATGGGATGAATAAACCAGTATGAtctaga

Personal tools