R03:GFP-tagged RASSL

From OpenWetWare

Revision as of 15:26, 25 June 2009 by Elana Urbansky (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Ro3: GFP-tagged RASSL May 23, 2001 Kimberly Scearce-Levie, Mike Lieberman, Sam Davis, Bruce Conklin

This is the RASSL Ro3, derived from Ro2, in turn derived from hKOR-FLAG/HA. All the sequence is identical to hKOR-FLAG/HA except for the mutations in extracellular loops 2 and 3 (making it a RASSL), and the addition on an N-terminal GFP tag. Emerald (green) Green Fluorescent Protein (GFP) is expressed as an in frame N-terminal fusion protein with the RASSL Ro2. GFP vector was purchased from Packard. GFP was cloned into Ro2 using the SacII restriction site between Arg 9 and Gly 10. Binding of spiradoline remains unaffected as assayed by FLIPR, while the receptor maintains its lack of affinity for endogenous ligands. Agonist induced receptor internalization is also not affected by the addition of the GFP tag.

Just like Ro1, Ro2 and hKOR-FLAG/HA: the 5' and 3' non-coding sequences have been removed, and N-terminal NLS from prolactin added, and the N-terminal FLAG epitope tag added. The NLS is reported to increase surface expression of receptors and is cleaved off leaving the free FLAG epitope that is recognized by the M1 antibody (available from Kodak-IBI). The NLS construct was a gift from Shaun Coughlin (Ishii, K, et. al., JBC, 1993, 268, 9780-9786). All portions of this construct that underwent PCR have been sequenced and are identical to the original human cDNA clone kindly provide by Dr.Lee-Yuan Liu-Chen (Zhu et. al., Life Sciences, 1995, Vol. 56, No 9, pg. 201-207).

The 5' unique cloning sites are Kpn I and Xho I. The 3' unique cloning site is Xba I, which is blocked by Dam methylation in Ro1 and Ro2 (because of a poor choice of the preceding sequence in the stop codon). This is no longer a problem in Ro3. In Ro3 the stop codon from the Dam-sensitive TGA to an insensitive TAA, removing the dam methylation site. This means you can use Xba I any time you Dam please (no need for Dam– cells with Ro3). Below are the DNA sequences for the Ro3 ORF and Ro3 in pcDNA3. The mutations in Ro2 that render it relatively impervious (2000 x decrease) to activation by endogenous opioids are noted in Coward et al PNAS, 1998, 95 pg. 352-357. All the sequence which is not hKOR derived is noted in lowercase. The Conklin Lab reference number for the Ro3 plasmid is pKSL1x. Please note that we have Ro3 in other vectors with different resistance (hygromycin), tetO-Ro3 and we hope to soon have Ro3 in a retroviral vector. TetO-Ro3 mice are also in development. Please feel free to inquire about updates. Transgene: Ro3 5´ primer: ggg CgA ggA gCT gTT CAC Cgg ggT ggT gCC 3´ primer: cGT TCT TCT gCT TgT Cgg CCA TgA TAT AgA Sequence of Ro3-ORF:

Atggacagcaaaggttcgtcgcagaaagggtcccgcctgctcctgctgctggtggtgtca aatctactcttgtgccagggtgtggtctccGATTACAAAGATGATGATGATGTCgacTCC CCGATCCAGATCTTCCGCggcatggTgagcaagggcgaggagctgttcaccggggtggtg cccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccGgcgag ggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaag ctgcccgtgccctggcccacccTcgtgaccaccttgacctacggcgtgcagtgcttcgcc cgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccGaaggctac gtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtg aagttcgagggcgacacccTggtgaaccgcatcgagctgaagggcatcgacttcaaggag gacggcaacatcctggggcacaagctggagtacaactacaacagccaCaaggtctatatc accgccgacaagcagaagaacggcatcaaggtgaacttcaagacccgccacaacatcgag gacggcagcgtgcagCtcgccgaccactaccagcagaacacccccatcggcgacggcccc gtgctgctgcccgacaaccactacctgagcacccagtccgcccTgagcaaagaccccaac gagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggc atggacgagctgTaccgcGGGGAGCCGGGCCCTACCTGCGCCCCGAGCGCCTGCCTGCCC CCCAACAGCAGCGCCTGGTTTCCCGGCTGGGCCGAGCCCGACAGCAACGGCAGCGCCGGC TCGGAGGACGCGCAGCTGGAGCCCGCGCACATCTCCCCGGCCATCCCGGTCATCATCACG GCGGTCTACTCCGTAGTGTTCGTCGTGGGCTTGGTGGGCAACTCGCTGGTCATGTTCGTG ATCATCCGATACACAAAGATGAAGACAGCAACCAACATTTACATATTTAACCTGGCTTTG GCAGATGCTTTAGTTACTACAACCATGCCCTTTCAGAGTACGGTCTACTTGATgaattct tggccttttggagatgttctgtgCaagattgtcatttccattgactactacaacatgttt accagcatattcaccttgaccatgatgagtgtggaccgttacattgccgtgtgccAccct gtgaaagctttggatttccgaacacctttgaaagcaaagatcatcaacatctgcatttgg ctactggcatcatctgttggtatatcaGcgatagtccttggggtgacccaaccccgggat ggagcagtggtatgcacgctccagttccccagccccagctggtactgggacactgtGacc aagatctGCGTCTTCATCTTTGCCTTCGTGATCCCTGTCCTCATCATCATCGTCTGCTAC ACCCTGATGATCCTGCGTCTCAAGAGCGTCCGGCTCCTTTCTGGCTCCCGAGAGAAAGAT CGCAACCTGCGTAGGATCACCAGACTGGTCCTGGTGGTGGTGGCAGTCTTCGTCGTCTGC TGGACTCCCATTCACATATTCATCCTAGTTCAGGCTCTGGGGAGCACCTCCCACAGCACA GCTGCTCTCTCCAGCTATTACTTCTGCATCGCCTTAGGCTATACCAACAGTAGCCTGAAT CCCATTCTCTACGCCTTTCTTGATGAAAACTTCAAGCGGTGTTTCCGGGACTTCTGCTTT CCACTGAAGATGAGGATGGAGCGGCAGAGCACTAGCAGAGTCCGAAATACAGTTCAGGAT CCTGCTTACCTGAGGGACATCGATGGGATGAATAAACCAGTATaAtctaga

Below is the entire sequence of Ro3-pcDNA3.

The ORF is starts at 982. All the changes from WT (FLAG, GFP, RASSL changes) are shown lower case.


Personal tools