Recipes & Protocols: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
(86 intermediate revisions by 2 users not shown)
Line 1: Line 1:
<!-- Delete this entire line as part of your first edit of your user page --> {{New user}}
===Tools===
*[http://useast.ensembl.org/index.html Ensembl]
*[http://primer3.wi.mit.edu/ Primer3Plus]
*[http://genome.ucsc.edu/cgi-bin/hgPcr USCS In-silico PCR]
*[http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ IDT OligoAnalyzer]
*[http://www.bioinformatics.org/sms/rev_comp.html Reverse complement]
*[http://ecoli.naist.jp/GB8-dev/index.jsp?page=gene_search.jsp&sf=T GenoBase Keio]
*[http://tools.neb.com/NEBcutter2/ DNA Restriction Site Analyzer]
*[http://syntheticbiology.org/Tools.html A list of commonly used syntethic biology tools] by SyntheticBiology.org


==Contact Info==
===Gene/Protein Info===
[[Image:OWWEmblem.png|thumb|right|Betul Kacar (an artistic interpretation)]]
*[http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi?INPUT_TYPE=live&SEQUENCE=YP_003046375.1 NCBI: EF-TU CD]


*Betul Kacar
===Protocols===
*Georgia Tech
*[http://openwetware.org/wiki/Choosing_primers_for_qPCR Choosing primers for q-PCR]
*Address 1
*[http://openwetware.org/wiki/PCR_Overlap_Extension Soeing PCR - Primer design]
*Address 2
*City, State, Country etc.  
*[[Special:Emailuser/Betul Kacar|Email me through OpenWetWare]]


{|
===Primer designing for gene expression profiling (bacteria)===
  table code goes here
|}


➢Get the gene name  (eg: MYD88)
*Go to NCBI (ncbi.nlm.nih.gov), and search in ‘Gene’ for the gene sequence.
*Type in REL606 (that is the E.coli strain we use, unless stated otherwise) together with the gene name, and get the NM number of the most common transcript variant. (eg: NM_002468.4 for MYD88)
*Click on the link and go to the gene description page.
*Scroll down and clink on the link to find the CDS, or the RefSeq.
*Copy the CDS sequence.
*Go to the Primer 3 Plus website (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and paste the CDS sequence in the search box.
*All the parameters for optimal primers are usually preset. Do not change anything.
*Click “pick primers’.
*When the selection of primers comes up, choose a pair that is closest to the 3’ end.
*<b>Check the primer is 20bp long and the product size is between 150-200bp.</b>


I work in the [[Your Lab]] at XYZ University. I learned about [[OpenWetWare]] from google, and I've joined because Creating a group meeting webpage..
*Blast to check the specificity of the primer pair (http://blast.ncbi.nlm.nih.gov/)
*Paste the forward and reverse primer sequences one by one and check if it gives a unique hit. (confirm chromosomal location of the gene from NCBI or other sources)
*If it gives multiple hits, select a different set of primers from Primer 3 Plus and repeat the same process until a unique set is obtained.


==Education==
➢ Order primers through Invitrogen:
<!--Include info about your educational background-->
*Purification: Desalted
* Year, PhD, Institute
*Starting Synthesis Scale: 25nmole
* Year, MS, Institute
*Ship Medium: Dry
* Year, BS, Institute
*Normalization: None
*Calculate primers to 100uM using DNA suspension Buffer from Teknova cat # T0221


==Research interests==
➢ Contact me if you have any questions (betul.kacar@biology.gatech.edu)
<!-- Feel free to add brief descriptions to your research interests as well -->
# Interest 1
# Interest 2
# Interest 3


==Publications==
===Primers for Kan===
<!-- Replace the PubMed ID's ("pmid=#######") below with the PubMed ID's for your publications.  You can add or remove lines as needed -->
<biblio>
#Paper1 pmid=6947258
#Paper2 pmid=13718526
// leave a comment about a paper here
#Book1 isbn=0879697164
</biblio>


==Useful links==
*Kan Cassette Test (Fwd): 5’ GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAG 3’
*[[OpenWetWare:Welcome|Introductory tutorial]]
*Kan Cassette Test (Rev): 5’ ATTCCGGGGATCCGTCGACCTGCAGTTCGAAGTTCCTATT 3’
*[[Help|OpenWetWare help pages]]
 
===Site-Directed Mutagenesis===
*[http://www.aidsreagent.org/pdfs/pet15b.pdf pET15b map]
*[http://www.chem.agilent.com/library/usermanuals/Public/210513.pdf QuikChange II STM Kit Protocol]
*[https://www.genomics.agilent.com/CollectionSubpage.aspx?PageType=Tool&SubPageType=ToolQCPD&PageID=15 QuikChange Primer Design (Agilent)]
 
=== LTE Assays===
araA Marker Test:
*Make sure to have: ''Hae''II Restriction Enzyme (in the -20C Freezer RE Stocks box), NEB Buffer 4, and good luck
*[http://barricklab.org/twiki/bin/view/Lab/ProtocolsAraMarker araA marker revertant test ]
 
===RT-PCR===
*[http://www.bio-rad.com/en-us/sku/170-9799-real-time-pcr-applications-guide BioRad Applications Guide]
*[http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/PCR/real-time-pcr/real-time-pcr-reagents/one-step-real-time-rt-master-mix/power-sybr-rna-to-ct-1-step.html Green RNA to CT of AB]
*[http://products.invitrogen.com/ivgn/product/AM1560 mirVana mRNA Isolation Kit]
*A helpful [http://pathmicro.med.sc.edu/pcr/realtime-home.htm tutorial] by Margaret Hunt
*[http://dunham.gs.washington.edu/protocols.shtml Dunham lab] has some very helpful tips on microarray & genotyping studies
 
===Gibson Assembly===
*[https://www.neb.com/~/media/NebUs/Files/Feature%20Articles/Gibson_Assembly.pdf Introduction to Gibson assembly]
*[http://2012.igem.org/Team:Freiburg/Project/Golden Golden Gate Cloning] (an alternative) (P: I've never tried this one before, but be my guest)
*J5 [http://j5.jbei.org/bin/login.pl Primer design tool]
 
 
----
: Compiled by Betül Kacar ''in the year twothousand''-thirteen.
: Team members: Lily Tran and Jen Zhang
: Contact betul_AT_gatech_DOT_edu for questions.

Revision as of 16:51, 13 December 2013

Tools

Gene/Protein Info

Protocols

Primer designing for gene expression profiling (bacteria)

➢Get the gene name (eg: MYD88)

  • Go to NCBI (ncbi.nlm.nih.gov), and search in ‘Gene’ for the gene sequence.
  • Type in REL606 (that is the E.coli strain we use, unless stated otherwise) together with the gene name, and get the NM number of the most common transcript variant. (eg: NM_002468.4 for MYD88)
  • Click on the link and go to the gene description page.
  • Scroll down and clink on the link to find the CDS, or the RefSeq.
  • Copy the CDS sequence.
  • Go to the Primer 3 Plus website (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and paste the CDS sequence in the search box.
  • All the parameters for optimal primers are usually preset. Do not change anything.
  • Click “pick primers’.
  • When the selection of primers comes up, choose a pair that is closest to the 3’ end.
  • Check the primer is 20bp long and the product size is between 150-200bp.
  • Blast to check the specificity of the primer pair (http://blast.ncbi.nlm.nih.gov/)
  • Paste the forward and reverse primer sequences one by one and check if it gives a unique hit. (confirm chromosomal location of the gene from NCBI or other sources)
  • If it gives multiple hits, select a different set of primers from Primer 3 Plus and repeat the same process until a unique set is obtained.

➢ Order primers through Invitrogen:

  • Purification: Desalted
  • Starting Synthesis Scale: 25nmole
  • Ship Medium: Dry
  • Normalization: None
  • Calculate primers to 100uM using DNA suspension Buffer from Teknova cat # T0221

➢ Contact me if you have any questions (betul.kacar@biology.gatech.edu)

Primers for Kan

  • Kan Cassette Test (Fwd): 5’ GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAG 3’
  • Kan Cassette Test (Rev): 5’ ATTCCGGGGATCCGTCGACCTGCAGTTCGAAGTTCCTATT 3’

Site-Directed Mutagenesis

LTE Assays

araA Marker Test:

  • Make sure to have: HaeII Restriction Enzyme (in the -20C Freezer RE Stocks box), NEB Buffer 4, and good luck
  • araA marker revertant test

RT-PCR

Gibson Assembly



Compiled by Betül Kacar in the year twothousand-thirteen.
Team members: Lily Tran and Jen Zhang
Contact betul_AT_gatech_DOT_edu for questions.