Recipes & Protocols

From OpenWetWare
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.

Tools

Gene/Protein Info

Protocols

Primer designing for gene expression profiling (bacteria)

➢Get the gene name (eg: MYD88)

  • Go to NCBI (ncbi.nlm.nih.gov), and search in ‘Gene’ for the gene sequence.
  • Type in REL606 (that is the E.coli strain we use, unless stated otherwise) together with the gene name, and get the NM number of the most common transcript variant. (eg: NM_002468.4 for MYD88)
  • Click on the link and go to the gene description page.
  • Scroll down and clink on the link to find the CDS, or the RefSeq.
  • Copy the CDS sequence.
  • Go to the Primer 3 Plus website (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and paste the CDS sequence in the search box.
  • All the parameters for optimal primers are usually preset. Do not change anything.
  • Click “pick primers’.
  • When the selection of primers comes up, choose a pair that is closest to the 3’ end.
  • Check the primer is 20bp long and the product size is between 150-200bp.
  • Blast to check the specificity of the primer pair (http://blast.ncbi.nlm.nih.gov/)
  • Paste the forward and reverse primer sequences one by one and check if it gives a unique hit. (confirm chromosomal location of the gene from NCBI or other sources)
  • If it gives multiple hits, select a different set of primers from Primer 3 Plus and repeat the same process until a unique set is obtained.

➢ Order primers through Invitrogen:

  • Purification: Desalted
  • Starting Synthesis Scale: 25nmole
  • Ship Medium: Dry
  • Normalization: None
  • Calculate primers to 100uM using DNA suspension Buffer from Teknova cat # T0221

➢ Contact me if you have any questions (betul.kacar@biology.gatech.edu)

Primers for Kan

  • Kan Cassette Test (Fwd): 5’ GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAG 3’
  • Kan Cassette Test (Rev): 5’ ATTCCGGGGATCCGTCGACCTGCAGTTCGAAGTTCCTATT 3’

Site-Directed Mutagenesis

Protein Expression and Purification