Recombineering/Lambda red-mediated gene replacement

From OpenWetWare

< Recombineering(Difference between revisions)
Jump to: navigation, search
(Procedure: day 2)
Current revision (15:41, 18 January 2010) (view source)
(14 intermediate revisions not shown.)
Line 1: Line 1:
{{back to protocols}}
Single-gene knockouts using λ red system, adapted from [ Datsenko and Wanner] paper.  The goal of this protocol was to create an endA (coding for endonuclease I) knockout, but obviously it can be adapted to any gene.  The knocked-out gene is replaced with an antibiotic resistance gene, usually for kanamycin or chloramphenicol.  In this example, the target strain was already kanamycin resistant, so the chloramphenicol resistance gene was used.
Single-gene knockouts using λ red system, adapted from [ Datsenko and Wanner] paper.  The goal of this protocol was to create an endA (endonuclease I) knockout, but obviously it can be adapted to any gene.  The knocked-out gene is replaced with an antibiotic resistance gene, usually for kanamycin or chloramphenicol.  In this example, the target strain was already kanamycin resistant, so the chloramphenicol resistance gene was used.
''Not a complete list — see protocol for details, or update this list'' --[[User:ShawnDouglas|smd]] 20:20, 5 March 2007 (EST)
Line 11: Line 13:
**incubators (30{{c}} and 37{{c}})
**incubators (30°C and 37°C)
*'''Geneeral outline'''
*'''General outline'''
**Grow up pKD46, pKD3, and pCP20 in current host strains
**Grow up pKD46, pKD3, and pCP20 in host strains
**Perform minipreps to extract plasmids
**Perform minipreps to extract plasmids
**Transform pKD46 into target strain
**Transform pKD46 into target strain, plate out on LB-amp plates
**PCR amplify linear fragment from pKD3 using oligos ''A'' and ''B'' (see below for design)
**PCR amplify linear fragment from pKD3 or pKD4 using oligos ''A'' and ''B'' (see below for design)
**Make target strain (now maintaining pKD46) electrocompetent by growing at 30{{c}} with L-arabinose
**Make target strain (now maintaining pKD46) electrocompetent by growing at 30°C with L-arabinose
**Electroprate linear DNA into electrocompetent cells
**Electroprate linear DNA into electrocompetent cells
**Grow at 37{{c}} on chloramphenicol plates
**Grow at 37°C on chloramphenicol plates
**PCR verify the deletion with oligos ''C'' and ''D'' (see below for design)
**PCR verify the deletion with oligos ''C'' and ''D'' (see below for design)
*'''Detailed procedure'''
*'''Detailed procedure'''
**This was my first attempt at this protocol, and I left out some of the proper controls.
*'''Day 0: Start overnight culture'''
*'''Day 0: Start overnight culture'''
**Start overnight culture of strain containing gene to knock out.
**Start overnight culture of strain containing gene to knock out.
Line 31: Line 32:
**Make new glycerol stock of overnight strain (grown from single colony)
**Make new glycerol stock of overnight strain (grown from single colony)
**Add 300 {{ul}} overnight culture to 30 mL LB medium (1:100 dilution)
**Add 300 {{ul}} overnight culture to 30 mL LB medium (1:100 dilution)
**Check density every 30 minutes starting at +1 hour; grow to {{od|600}} of 0.3 to 0.4
**Check culture density every 30 minutes starting at +1 hour; grow to {{od|600}} of 0.3 to 0.4
**{{od|600}} measurements  
**{{od|600}} measurements of K91
***+2:00 hrs: 0.06
***+2:00 hrs: 0.06
***+2:45 hrs: 0.3008
***+2:45 hrs: 0.3008
**Spin at 2500rcf for 10 minutes at 4{{c}} in two 50 mL centrifuge tubes (JA-20 rotor)
**Spin at 2500rcf for 10 minutes at 4°C in two 50 mL centrifuge tubes (JA-20 rotor)
**Decant supernatant, discard
**Decant supernatant, discard
**Resuspend each pellet in 5 mL ice cold transformation buffer; swirl or pipette gently to mix
**Resuspend each pellet in 5 mL ice cold transformation buffer; swirl or pipette gently to mix
Line 46: Line 47:
***Filter sterilize
***Filter sterilize
**Incubate on ice for 10 min
**Incubate on ice for 10 min
**Spin at 2500rcf for 10 minutes at 4{{c}}
**Spin at 2500rcf for 10 minutes at 4°C
**Decant supernatant, discard
**Decant supernatant, discard
**Resuspend each pellet in 1.25 mL ice cold transformation buffer
**Resuspend each pellet in 1.25 mL ice cold transformation buffer
Line 54: Line 55:
**Incubate on ice for 10 min
**Incubate on ice for 10 min
**Aliquot 400 {{ul}} each into five 1.5 mL tubes
**Aliquot 400 {{ul}} each into five 1.5 mL tubes
**Store in -80{{c}} freezer.
**Store in -80°C freezer.
**Transform strain with pKD46 and grow on LB-amp-kan plate at 30{{c}}
**Transform strain with pKD46 and grow on LB-amp plate at 30°C
***Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA
***Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA
***Add 100 {{ul}} of competent cell mix to each tube
***Add 100 {{ul}} of competent cell mix to each tube
***Incubate on ice 30 min
***Incubate on ice 30 min
***Heat shock 30 seconds at 42{{c}}
***Heat shock 30 seconds at 42°C
***Incubate on ice 2 min
***Incubate on ice 2 min
***Spread all 100 {{ul}} on LB-amp-kan plate
***Spread all 100 {{ul}} on LB-amp-kan plate
***Incubate at 30{{c}} overnight
***Incubate at 30°C overnight
**PCR endA-CmR from pKD3
**U45endA—pKD3[Cat]—D45endA fragment is chloramphenicol cassette with FRT sequences, flanked by 45 bp upstream and downstream of endA.
***PCR program: 95{{c}} 7min &rarr; 20*[94{{c}} 15s &rarr; 50{{c}} 30s &rarr; 72{{c}} 90s]
**PCR U45endA— pKD3[Cat]—D45endA from pKD3 and verify on gel
{| {{table}}
***PCR program: 95°C 7min &rarr; 35*[94°C 15s &rarr; 50°C 30s &rarr; 72°C 90s]
::{| {{table}}
| align="center" style="background:#f0f0f0;"|'''Contents'''
| align="center" style="background:#f0f0f0;"|'''Contents'''
| align="center" style="background:#f0f0f0;"|'''Concentration'''
| align="center" style="background:#f0f0f0;"|'''Concentration'''
Line 86: Line 88:
| d{{h2o}}||-||64.5 {{ul}}
| d{{h2o}}||-||64.5 {{ul}}
**Make ten 10 {{ug}}/ml chloramphenicol plates and ten 25 {{ug}}/ml chloramphenicol plates
*'''Day 2'''
*'''Day 2'''
**Make 1 M stock of L-arabinose
**Make 1 M stock of L-arabinose
Line 91: Line 95:
***Add 1501.3 mg of L-arabinose to 8.5 g d{{h2o}} to make 1 M stock
***Add 1501.3 mg of L-arabinose to 8.5 g d{{h2o}} to make 1 M stock
**Retrieve plates from incubator
**Retrieve plates from incubator
**Good results from the transformation
**Check results from the transformation
***1 ng pKD46 transformation yielded about 10 colonies
***1 ng pKD46 transformation yielded about 10 colonies
***10 ng pKD46 transformation yielded about 100 colonies
***10 ng pKD46 transformation yielded about 100 colonies
***100 ng pKD46 transformation yielded several hundred colonies
***100 ng pKD46 transformation yielded several hundred colonies
**Pick some colonies (I picked 3)
**Pick some colonies and grow at 30°C in 2 mL LB + 50 {{ug}}/mL Amp
**Grow at 30{{c}} in 2 mL LB + 50 {{ug}}/mL Amp
***add 50 {{ul}} 10 mg/mL Ampicillin stock
**Make ten 10 {{ug}}/ml chloramphenicol plates and ten 10 {{ug}}/ml chloramphenicol plates
**Include enough samples for two conditions: +/- L-arabinose induction
**After about 7-8 hrs on shaker, measured {{od|600}} of cells(+pKD46) at 1.05
**When {{od|600}} of cells(+pKD46) reaches 0.1, add L-arabinose to concentration of 10 mM to induce pKD46 &lambda;-red expression
**Made 1/10, 1/20 dilutions of cultures in fresh 2 mL LB + 50 {{ug}}/mL Amp + 10 mM L-arabinose
***add 20 {{ul}} 1 M L-arabinose to 2 mL culture
***Include enough samples for two conditions: +/- L-arabinose induction
**Continue to grow at 30°C to {{od|600}} = 0.4
****50 {{ul}} 10 mg/mL (=10 {{ug}}/{{ul}}) Ampicillin
****100 {{ul}} 1 M L-arabinose
***Grow on shaker at 30{{c}}
**Start four 2 mL LB-amp cultures using 1/100 dilution of cells (target strain +pKD46)
**Grow at 30{{c}} to {{od|600}} = 0.25
**Add L-arabinose to concentration of 10 mM to induce pKD46 &lambda;-red expression
***20 {{ul}} of 1 M L-arabinose to 2 mL culture
**Continue at 30{{c}} to {{od|600}} = 0.5
**Aliquot 1 mL each into two 1.5 mL centrifuge tubes
**Aliquot 1 mL each into two 1.5 mL centrifuge tubes
**Chill cells in ice-water bath 10 minutes
**Chill cells in ice-water bath 10 minutes
**Centrifuge 10 min at 4000rcf 4{{c}}
**Centrifuge 10 min at 4000rcf 4°C
**Pipette off supernatant and resuspend pellets in 1 mL ice-cold d{{h2o}}
**Pipette off supernatant and resuspend pellets in 1 mL ice-cold d{{h2o}}
**Centrifuge 10 min at 4000rcf 4{{c}}
**Centrifuge 10 min at 4000rcf 4°C
**Resuspend pellet in 50 {{ul}} d{{h2o}}
**Resuspend pellet in 50 {{ul}} d{{h2o}}
**For electroporation step, include 2 conditions: +/- PCR fragment
**For electroporation step, include 2 conditions: +/- PCR fragment
**Chill electroporation cuvettes for 5 minutes on ice
**Chill electroporation cuvettes for 5 minutes on ice
**Add 5 pg to 0.5 {{ug}} DNA (PCR fragment from pKD3) to cells
**Add 5 pg to 0.5 {{ug}} PCR amplified DNA to cells
**Set electroporation apparatus to 2.5 kV, 25 &mu;F.  Set the pulse controller to 200 ohms
**Set electroporation apparatus to 2.5 kV, 25 &mu;F.  Set the pulse controller to 200 ohms
**Place the cuvette into the sample chamber
**Place the cuvette into the sample chamber
**Apply the pulse by pushing the button
**Apply the pulse by pushing the button
**Remove the cuvette.  Immediately add 1 mL LB medium and transfer to a sterile culture tube
**Remove the cuvette.  Immediately add 1 mL LB medium and transfer to a sterile culture tube
**Incubate 60-120 min with moderate shaking at 37{{c}}
**Incubate 60-120 min with moderate shaking at 37°C
**Plate aliquots of the transformation culture on LB plates supplemented with chloramphenicol (10 {{ug}}/mL, 20 {{ug}}/mL)
**Plate aliquots of the transformation culture on LB plates supplemented with chloramphenicol (10 {{ug}}/mL, 25 {{ug}}/mL)
Line 134: Line 130:
*pKD3 CmR sequence (1033 bases)
*pKD3 Cat sequence (1034 bases)
<span style="font-family:Courier,monospace;">
<span style="font-family:Courier,monospace;">
Line 174: Line 170:
*Figure out the sequence and size of what you should expect if everything works.  In this case, it's CmR inserted into endA flanking region''' (1132 bases total)
*Figure out the sequence and size of what you should expect if everything works.  In this case, it's Cat inserted into endA flanking region''' (1132 bases total)
<span style="font-family:Courier,monospace;">
<span style="font-family:Courier,monospace;">
#Datsenko-PNAS-2000 pmid=10829079
'''λ red Links'''
'''λ red Links'''
*[ Schematic Overview]
*[ Schematic Overview]
Line 200: Line 198:
*[ Entrez Gene: endA]
*[ Entrez Gene: endA]
*[ ASAP annotation for K12 endA]
*[ ASAP annotation for K12 endA]
#Datsenko-PNAS-2000 pmid=10829079
*[[User:ShawnDouglas|Shawn Douglas]] — posted original protocol, performed once in August 2006.
*[[User:ShawnDouglas|Shawn Douglas]] — posted original protocol, performed once in August 2006.
[[Category:Protocol]] [[Category:Escherichia coli]]

Current revision

back to protocols



Single-gene knockouts using λ red system, adapted from Datsenko and Wanner paper. The goal of this protocol was to create an endA (endonuclease I) knockout, but obviously it can be adapted to any gene. The knocked-out gene is replaced with an antibiotic resistance gene, usually for kanamycin or chloramphenicol. In this example, the target strain was already kanamycin resistant, so the chloramphenicol resistance gene was used.


Not a complete list — see protocol for details, or update this list --smd 20:20, 5 March 2007 (EST)

  • plasmids
    • pKD46
    • pKD3 (chloramphenicol)
    • pKD4 (kanamycin)
    • pCP20 (optional)
  • reagents
    • L-arabinose
  • equipment
    • incubators (30°C and 37°C)
    • electroporator


  • General outline
    • Grow up pKD46, pKD3, and pCP20 in host strains
    • Perform minipreps to extract plasmids
    • Transform pKD46 into target strain, plate out on LB-amp plates
    • PCR amplify linear fragment from pKD3 or pKD4 using oligos A and B (see below for design)
    • Make target strain (now maintaining pKD46) electrocompetent by growing at 30°C with L-arabinose
    • Electroprate linear DNA into electrocompetent cells
    • Grow at 37°C on chloramphenicol plates
    • PCR verify the deletion with oligos C and D (see below for design)
  • Detailed procedure
  • Day 0: Start overnight culture
    • Start overnight culture of strain containing gene to knock out.
  • Day 1: Preparation and transformation of competent cells
    • Make new glycerol stock of overnight strain (grown from single colony)
    • Add 300 μL overnight culture to 30 mL LB medium (1:100 dilution)
    • Check culture density every 30 minutes starting at +1 hour; grow to OD600 of 0.3 to 0.4
    • OD600 measurements of K91
      • +2:00 hrs: 0.06
      • +2:45 hrs: 0.3008
    • Spin at 2500rcf for 10 minutes at 4°C in two 50 mL centrifuge tubes (JA-20 rotor)
    • Decant supernatant, discard
    • Resuspend each pellet in 5 mL ice cold transformation buffer; swirl or pipette gently to mix
      • Transformation Buffer
      • 10 mM Pipes
      • 15 mM CaCl2
      • 250 mM KCl
      • Titrate to pH 6.7 before adding MnCl2
      • 55 mM MnCl2
      • Filter sterilize
    • Incubate on ice for 10 min
    • Spin at 2500rcf for 10 minutes at 4°C
    • Decant supernatant, discard
    • Resuspend each pellet in 1.25 mL ice cold transformation buffer
    • Combine resuspended pellets in single tube
    • Remove 400 μL for immediate transformation
    • Add DMSO to a final concentration of 7% (160 μL). Drip the DMSO slowly into the cell suspension, with constant swirling by hand.
    • Incubate on ice for 10 min
    • Aliquot 400 μL each into five 1.5 mL tubes
    • Store in -80°C freezer.
    • Transform strain with pKD46 and grow on LB-amp plate at 30°C
      • Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA
      • Add 100 μL of competent cell mix to each tube
      • Incubate on ice 30 min
      • Heat shock 30 seconds at 42°C
      • Incubate on ice 2 min
      • Spread all 100 μL on LB-amp-kan plate
      • Incubate at 30°C overnight
    • U45endA—pKD3[Cat]—D45endA fragment is chloramphenicol cassette with FRT sequences, flanked by 45 bp upstream and downstream of endA.
    • PCR U45endA— pKD3[Cat]—D45endA from pKD3 and verify on gel
      • PCR program: 95°C 7min → 35*[94°C 15s → 50°C 30s → 72°C 90s]
Contents Concentration Volume
pKD3 template45 ng/μL0.5 μL
forward primer10 μM5 μL
reverse primer10 μM5 μL
10x KOD buffer-10 μL
dNTP2 mM10 μL
MgSO425 mM4 μL
KOD polymerase2 μL
dH2O-64.5 μL
    • Make ten 10 μg/ml chloramphenicol plates and ten 25 μg/ml chloramphenicol plates
  • Day 2
    • Make 1 M stock of L-arabinose
      • MW of L-arabinose is 150.13
      • Add 1501.3 mg of L-arabinose to 8.5 g dH2O to make 1 M stock
    • Retrieve plates from incubator
    • Check results from the transformation
      • 1 ng pKD46 transformation yielded about 10 colonies
      • 10 ng pKD46 transformation yielded about 100 colonies
      • 100 ng pKD46 transformation yielded several hundred colonies
    • Pick some colonies and grow at 30°C in 2 mL LB + 50 μg/mL Amp
      • add 50 μL 10 mg/mL Ampicillin stock
    • Include enough samples for two conditions: +/- L-arabinose induction
    • When OD600 of cells(+pKD46) reaches 0.1, add L-arabinose to concentration of 10 mM to induce pKD46 λ-red expression
      • add 20 μL 1 M L-arabinose to 2 mL culture
    • Continue to grow at 30°C to OD600 = 0.4
    • Aliquot 1 mL each into two 1.5 mL centrifuge tubes
    • Chill cells in ice-water bath 10 minutes
    • Centrifuge 10 min at 4000rcf 4°C
    • Pipette off supernatant and resuspend pellets in 1 mL ice-cold dH2O
    • Centrifuge 10 min at 4000rcf 4°C
    • Resuspend pellet in 50 μL dH2O
    • For electroporation step, include 2 conditions: +/- PCR fragment
    • Chill electroporation cuvettes for 5 minutes on ice
    • Add 5 pg to 0.5 μg PCR amplified DNA to cells
    • Set electroporation apparatus to 2.5 kV, 25 μF. Set the pulse controller to 200 ohms
    • Place the cuvette into the sample chamber
    • Apply the pulse by pushing the button
    • Remove the cuvette. Immediately add 1 mL LB medium and transfer to a sterile culture tube
    • Incubate 60-120 min with moderate shaking at 37°C
    • Plate aliquots of the transformation culture on LB plates supplemented with chloramphenicol (10 μg/mL, 25 μg/mL)


Designing necessary primers

  • First look at the sequence of the plasmid containing the resistance marker you wish to swap in for your target gene.
    • NCBI sequence viewer: pKD3
      • priming site 1: GTGTAGGCTGGAGCTGCTTC
      • priming site 2: GGACCATGGCTAATTCCCAT
      • priming site 2 reverse complement: ATGGGAATTAGCCATGGTCC

  • pKD3 Cat sequence (1034 bases)


  • Next, find the sequence (and context sequence) of the gene you wish to remove
    • In this example, I found the sequence and context for endA (808 bases total)
      • MG1655_m56_ABE-0009661 +50bp upstream +50bp downstream


  • Construct primers that have internal overlap with the resistance marker (pKD3) and external overlap with the target knockout gene (endA).
    • Forward primer: A
    • Reverse primer: B
  • Construct primers that only flank the target gene (endA) for PCR verification
    • Forward primer: C
    • Reverse primer: D
  • Figure out the sequence and size of what you should expect if everything works. In this case, it's Cat inserted into endA flanking region (1132 bases total)




  1. Datsenko KA and Wanner BL. . pmid:10829079. PubMed HubMed [Datsenko-PNAS-2000]

λ red Links

endA Links


  • Shawn Douglas — posted original protocol, performed once in August 2006.
Personal tools