Recombineering/Lambda red-mediated gene replacement - Revision history

ShawnDouglas: /* Notes */

2010-01-18T19:41:57Z

Notes

←Older revision		Revision as of 19:41, 18 January 2010
Line 130:		Line 130:


-	*pKD3 Cat sequence (~~1033~~ bases)	+	*pKD3 Cat sequence (1034 bases)
	<span style="font-family:Courier,monospace;">		<span style="font-family:Courier,monospace;">
	{{blue\|GTGTAGGCTGGAGCTGCTTC}}GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCC		{{blue\|GTGTAGGCTGGAGCTGCTTC}}GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCC

ShawnDouglas: Added A into pKD3 cat sequence as suggested on talk page

2010-01-18T19:40:20Z

Added A into pKD3 cat sequence as suggested on talk page

←Older revision		Revision as of 19:40, 18 January 2010
Line 132:		Line 132:
	*pKD3 Cat sequence (1033 bases)		*pKD3 Cat sequence (1033 bases)
	<span style="font-family:Courier,monospace;">		<span style="font-family:Courier,monospace;">
-	{{blue\|GTGTAGGCTGGAGCTGCTTC}}~~GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCTTTAAATGGCGCGCCTTACGCCCCGCCC~~	+	{{blue\|GTGTAGGCTGGAGCTGCTTC}}GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCC
	TGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTC		TGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTC
	GCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGA		GCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGA

ShawnDouglas: fixed °C

2010-01-18T19:37:59Z

fixed °C

←Older revision		Revision as of 19:37, 18 January 2010
Line 13:		Line 13:
	**L-arabinose		**L-arabinose
	*equipment		*equipment
-	**incubators (~~30{{c}}~~ and ~~37{{c}}~~)	+	**incubators (30°C and 37°C)
	**electroporator		**electroporator

Line 22:		Line 22:
	**Transform pKD46 into target strain, plate out on LB-amp plates		**Transform pKD46 into target strain, plate out on LB-amp plates
	**PCR amplify linear fragment from pKD3 or pKD4 using oligos ''A'' and ''B'' (see below for design)		**PCR amplify linear fragment from pKD3 or pKD4 using oligos ''A'' and ''B'' (see below for design)
-	**Make target strain (now maintaining pKD46) electrocompetent by growing at ~~30{{c}}~~ with L-arabinose	+	**Make target strain (now maintaining pKD46) electrocompetent by growing at 30°C with L-arabinose
	**Electroprate linear DNA into electrocompetent cells		**Electroprate linear DNA into electrocompetent cells
-	**Grow at ~~37{{c}}~~ on chloramphenicol plates	+	**Grow at 37°C on chloramphenicol plates
	**PCR verify the deletion with oligos ''C'' and ''D'' (see below for design)		**PCR verify the deletion with oligos ''C'' and ''D'' (see below for design)
	*'''Detailed procedure'''		*'''Detailed procedure'''
Line 36:		Line 36:
	***+2:00 hrs: 0.06		***+2:00 hrs: 0.06
	***+2:45 hrs: 0.3008		***+2:45 hrs: 0.3008
-	**Spin at 2500rcf for 10 minutes at ~~4{{c}}~~ in two 50 mL centrifuge tubes (JA-20 rotor)	+	**Spin at 2500rcf for 10 minutes at 4°C in two 50 mL centrifuge tubes (JA-20 rotor)
	**Decant supernatant, discard		**Decant supernatant, discard
	**Resuspend each pellet in 5 mL ice cold transformation buffer; swirl or pipette gently to mix		**Resuspend each pellet in 5 mL ice cold transformation buffer; swirl or pipette gently to mix
Line 47:		Line 47:
	***Filter sterilize		***Filter sterilize
	**Incubate on ice for 10 min		**Incubate on ice for 10 min
-	**Spin at 2500rcf for 10 minutes at ~~4{{c}}~~	+	**Spin at 2500rcf for 10 minutes at 4°C
	**Decant supernatant, discard		**Decant supernatant, discard
	**Resuspend each pellet in 1.25 mL ice cold transformation buffer		**Resuspend each pellet in 1.25 mL ice cold transformation buffer
Line 55:		Line 55:
	**Incubate on ice for 10 min		**Incubate on ice for 10 min
	**Aliquot 400 {{ul}} each into five 1.5 mL tubes		**Aliquot 400 {{ul}} each into five 1.5 mL tubes
-	**Store in -~~80{{c}}~~ freezer.	+	**Store in -80°C freezer.
-	**Transform strain with pKD46 and grow on LB-amp plate at ~~30{{c}}~~	+	**Transform strain with pKD46 and grow on LB-amp plate at 30°C
	***Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA		***Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA
	***Add 100 {{ul}} of competent cell mix to each tube		***Add 100 {{ul}} of competent cell mix to each tube
	***Incubate on ice 30 min		***Incubate on ice 30 min
-	***Heat shock 30 seconds at ~~42{{c}}~~	+	***Heat shock 30 seconds at 42°C
	***Incubate on ice 2 min		***Incubate on ice 2 min
	***Spread all 100 {{ul}} on LB-amp-kan plate		***Spread all 100 {{ul}} on LB-amp-kan plate
-	***Incubate at ~~30{{c}}~~ overnight	+	***Incubate at 30°C overnight
	**U45endA—pKD3[Cat]—D45endA fragment is chloramphenicol cassette with FRT sequences, flanked by 45 bp upstream and downstream of endA.		**U45endA—pKD3[Cat]—D45endA fragment is chloramphenicol cassette with FRT sequences, flanked by 45 bp upstream and downstream of endA.
	**PCR U45endA— pKD3[Cat]—D45endA from pKD3 and verify on gel		**PCR U45endA— pKD3[Cat]—D45endA from pKD3 and verify on gel
-	**PCR program: ~~95{{c}}~~ 7min → 35[~~94{{c}}~~ 15s → ~~50{{c}}~~ 30s → ~~72{{c}}~~ 90s]	+	**PCR program: 95°C 7min → 35[94°C 15s → 50°C 30s → 72°C 90s]
	::{\| {{table}}		::{\| {{table}}
	\| align="center" style="background:#f0f0f0;"\|'''Contents'''		\| align="center" style="background:#f0f0f0;"\|'''Contents'''
Line 99:		Line 99:
	***10 ng pKD46 transformation yielded about 100 colonies		***10 ng pKD46 transformation yielded about 100 colonies
	***100 ng pKD46 transformation yielded several hundred colonies		***100 ng pKD46 transformation yielded several hundred colonies
-	**Pick some colonies and grow at ~~30{{c}}~~ in 2 mL LB + 50 {{ug}}/mL Amp	+	**Pick some colonies and grow at 30°C in 2 mL LB + 50 {{ug}}/mL Amp
	***add 50 {{ul}} 10 mg/mL Ampicillin stock		***add 50 {{ul}} 10 mg/mL Ampicillin stock
	**Include enough samples for two conditions: +/- L-arabinose induction		**Include enough samples for two conditions: +/- L-arabinose induction
	**When {{od\|600}} of cells(+pKD46) reaches 0.1, add L-arabinose to concentration of 10 mM to induce pKD46 λ-red expression		**When {{od\|600}} of cells(+pKD46) reaches 0.1, add L-arabinose to concentration of 10 mM to induce pKD46 λ-red expression
	***add 20 {{ul}} 1 M L-arabinose to 2 mL culture		***add 20 {{ul}} 1 M L-arabinose to 2 mL culture
-	**Continue to grow at ~~30{{c}}~~ to {{od\|600}} = 0.4	+	**Continue to grow at 30°C to {{od\|600}} = 0.4
	**Aliquot 1 mL each into two 1.5 mL centrifuge tubes		**Aliquot 1 mL each into two 1.5 mL centrifuge tubes
	**Chill cells in ice-water bath 10 minutes		**Chill cells in ice-water bath 10 minutes
-	**Centrifuge 10 min at 4000rcf ~~4{{c}}~~	+	**Centrifuge 10 min at 4000rcf 4°C
	**Pipette off supernatant and resuspend pellets in 1 mL ice-cold d{{h2o}}		**Pipette off supernatant and resuspend pellets in 1 mL ice-cold d{{h2o}}
-	**Centrifuge 10 min at 4000rcf ~~4{{c}}~~	+	**Centrifuge 10 min at 4000rcf 4°C
	**Resuspend pellet in 50 {{ul}} d{{h2o}}		**Resuspend pellet in 50 {{ul}} d{{h2o}}
	**For electroporation step, include 2 conditions: +/- PCR fragment		**For electroporation step, include 2 conditions: +/- PCR fragment
Line 118:		Line 118:
	**Apply the pulse by pushing the button		**Apply the pulse by pushing the button
	**Remove the cuvette. Immediately add 1 mL LB medium and transfer to a sterile culture tube		**Remove the cuvette. Immediately add 1 mL LB medium and transfer to a sterile culture tube
-	**Incubate 60-120 min with moderate shaking at ~~37{{c}}~~	+	**Incubate 60-120 min with moderate shaking at 37°C
	**Plate aliquots of the transformation culture on LB plates supplemented with chloramphenicol (10 {{ug}}/mL, 25 {{ug}}/mL)		**Plate aliquots of the transformation culture on LB plates supplemented with chloramphenicol (10 {{ug}}/mL, 25 {{ug}}/mL)

Torsten Waldminghaus at 17:09, 23 February 2009

2009-02-23T17:09:37Z

←Older revision		Revision as of 17:09, 23 February 2009
Line 1:		Line 1:
		+	{{back to protocols}}
	==Overview==		==Overview==
	Single-gene knockouts using λ red system, adapted from [http://www.pnas.org/cgi/content/full/97/12/6640 Datsenko and Wanner] paper. The goal of this protocol was to create an endA (endonuclease I) knockout, but obviously it can be adapted to any gene. The knocked-out gene is replaced with an antibiotic resistance gene, usually for kanamycin or chloramphenicol. In this example, the target strain was already kanamycin resistant, so the chloramphenicol resistance gene was used.		Single-gene knockouts using λ red system, adapted from [http://www.pnas.org/cgi/content/full/97/12/6640 Datsenko and Wanner] paper. The goal of this protocol was to create an endA (endonuclease I) knockout, but obviously it can be adapted to any gene. The knocked-out gene is replaced with an antibiotic resistance gene, usually for kanamycin or chloramphenicol. In this example, the target strain was already kanamycin resistant, so the chloramphenicol resistance gene was used.

ShawnDouglas: /* Notes */

2007-09-30T20:32:18Z

Notes

ShawnDouglas at 10:17, 29 May 2007

2007-05-29T10:17:04Z

←Older revision		Revision as of 10:17, 29 May 2007
Line 3:		Line 3:

	==Materials==		==Materials==
-	''Not a complete list — see protocol for details, or update this list :)'' --[[User:ShawnDouglas\|smd]] 20:20, 5 March 2007 (EST)	+	''Not a complete list — see protocol for details, or update this list'' --[[User:ShawnDouglas\|smd]] 20:20, 5 March 2007 (EST)
	*plasmids		*plasmids
	**pKD46		**pKD46
Line 17:		Line 17:
	==Procedure==		==Procedure==
	*'''General outline'''		*'''General outline'''
-	**Grow up pKD46, pKD3, and pCP20 in ~~current~~ host strains	+	**Grow up pKD46, pKD3, and pCP20 in host strains
	**Perform minipreps to extract plasmids		**Perform minipreps to extract plasmids
-	**Transform pKD46 into target strain	+	**Transform pKD46 into target strain, plate out on LB-amp plates
-	**PCR amplify linear fragment from pKD3 using oligos ''A'' and ''B'' (see below for design)	+	**PCR amplify linear fragment from pKD3 or pKD4 using oligos ''A'' and ''B'' (see below for design)
	**Make target strain (now maintaining pKD46) electrocompetent by growing at 30{{c}} with L-arabinose		**Make target strain (now maintaining pKD46) electrocompetent by growing at 30{{c}} with L-arabinose
	**Electroprate linear DNA into electrocompetent cells		**Electroprate linear DNA into electrocompetent cells
Line 26:		Line 26:
	**PCR verify the deletion with oligos ''C'' and ''D'' (see below for design)		**PCR verify the deletion with oligos ''C'' and ''D'' (see below for design)
	*'''Detailed procedure'''		*'''Detailed procedure'''
-	**This was my first attempt at this protocol, and I left out some of the proper controls. Feel free to fix anything that seems erroneous. --[[User:ShawnDouglas\|smd]] 20:21, 5 March 2007 (EST)
	*'''Day 0: Start overnight culture'''		*'''Day 0: Start overnight culture'''
	**Start overnight culture of strain containing gene to knock out.		**Start overnight culture of strain containing gene to knock out.
Line 32:		Line 31:
	**Make new glycerol stock of overnight strain (grown from single colony)		**Make new glycerol stock of overnight strain (grown from single colony)
	**Add 300 {{ul}} overnight culture to 30 mL LB medium (1:100 dilution)		**Add 300 {{ul}} overnight culture to 30 mL LB medium (1:100 dilution)
-	**Check density every 30 minutes starting at +1 hour; grow to {{od\|600}} of 0.3 to 0.4	+	**Check culture density every 30 minutes starting at +1 hour; grow to {{od\|600}} of 0.3 to 0.4
-	**{{od\|600}} measurements	+	**{{od\|600}} measurements of K91
	***+2:00 hrs: 0.06		***+2:00 hrs: 0.06
	***+2:45 hrs: 0.3008		***+2:45 hrs: 0.3008
Line 64:		Line 63:
	***Spread all 100 {{ul}} on LB-amp-kan plate		***Spread all 100 {{ul}} on LB-amp-kan plate
	***Incubate at 30{{c}} overnight		***Incubate at 30{{c}} overnight
-	**~~PCR~~ endA~~-CmR~~ from pKD3 and verify on gel	+	**U45endA—pKD3[Cat]—D45endA fragment is chloramphenicol cassette with FRT sequences, flanked by 45 bp upstream and downstream of endA.
		+	**PCR U45endA— pKD3[Cat]—D45endA from pKD3 and verify on gel
	**PCR program: 95{{c}} 7min → 35[94{{c}} 15s → 50{{c}} 30s → 72{{c}} 90s]		**PCR program: 95{{c}} 7min → 35[94{{c}} 15s → 50{{c}} 30s → 72{{c}} 90s]
	::{\| {{table}}		::{\| {{table}}
Line 87:		Line 87:
	\| d{{h2o}}\|\|-\|\|64.5 {{ul}}		\| d{{h2o}}\|\|-\|\|64.5 {{ul}}
	\|}		\|}
		+	**Make ten 10 {{ug}}/ml chloramphenicol plates and ten 25 {{ug}}/ml chloramphenicol plates
		+
	*'''Day 2'''		*'''Day 2'''
	**Make 1 M stock of L-arabinose		**Make 1 M stock of L-arabinose
Line 92:		Line 94:
	***Add 1501.3 mg of L-arabinose to 8.5 g d{{h2o}} to make 1 M stock		***Add 1501.3 mg of L-arabinose to 8.5 g d{{h2o}} to make 1 M stock
	**Retrieve plates from incubator		**Retrieve plates from incubator
-	**~~Good~~ results from the transformation	+	**Check results from the transformation
	***1 ng pKD46 transformation yielded about 10 colonies		***1 ng pKD46 transformation yielded about 10 colonies
	***10 ng pKD46 transformation yielded about 100 colonies		***10 ng pKD46 transformation yielded about 100 colonies
	***100 ng pKD46 transformation yielded several hundred colonies		***100 ng pKD46 transformation yielded several hundred colonies
-	**Pick some colonies ~~(I picked 3)~~	+	**Pick some colonies and grow at 30{{c}} in 2 mL LB + 50 {{ug}}/mL Amp
-	**Grow at 30{{c}} in 2 mL LB + 50 {{ug}}/mL Amp	+	***add 50 {{ul}} 10 mg/mL Ampicillin stock
-	**~~Make ten 10 {{ug}}/ml chloramphenicol plates and ten 10 {{ug}}/ml chloramphenicol plates~~	+	**Include enough samples for two conditions: +/- L-arabinose induction
-	**After about 7-8 hrs on shaker, measured {{~~od\|600~~}} ~~of cells(+pKD46) at 1.05~~	+	**When {{od\|600}} of cells(+pKD46) reaches 0.1, add L-arabinose to concentration of 10 mM to induce pKD46 λ-red expression
-	**Made 1/10~~, 1~~/~~20 dilutions of cultures in fresh 2~~ mL ~~LB + 50 {{ug}}/mL Amp + 10 mM L-arabinose~~	+	***add 20 {{ul}} 1 M L-arabinose to 2 mL culture
-	***Include enough samples for two conditions: +/- L-arabinose induction	+	**Continue to grow at 30{{c}} to {{od\|600}} = 0.4
-	****50 {{ul}} ~~10 mg/mL (=10 {{ug}}/{{ul}}) Ampicillin~~	+
-	****100 {{ul}} 1 M L-arabinose	+
-	***Grow on shaker at 30{{c}}	+
-	**Start four 2 mL LB-amp cultures using 1/100 dilution of cells (~~target strain~~ +pKD46)	+
-	**Grow at 30{{c}} to {{od\|600}} = 0.25	+
-	**Add L-arabinose to concentration of 10 mM to induce pKD46 λ-red expression	+
-	***20 {{ul}} of 1 M L-arabinose to 2 mL culture	+
-	**Continue at 30{{c}} to {{od\|600}} = 0.5	+
	**Aliquot 1 mL each into two 1.5 mL centrifuge tubes		**Aliquot 1 mL each into two 1.5 mL centrifuge tubes
	**Chill cells in ice-water bath 10 minutes		**Chill cells in ice-water bath 10 minutes
Line 118:		Line 112:
	**For electroporation step, include 2 conditions: +/- PCR fragment		**For electroporation step, include 2 conditions: +/- PCR fragment
	**Chill electroporation cuvettes for 5 minutes on ice		**Chill electroporation cuvettes for 5 minutes on ice
-	**Add 5 pg to 0.5 {{ug}} ~~DNA (~~PCR ~~fragment from pKD3)~~ to cells	+	**Add 5 pg to 0.5 {{ug}} PCR amplified DNA to cells
	**Set electroporation apparatus to 2.5 kV, 25 μF. Set the pulse controller to 200 ohms		**Set electroporation apparatus to 2.5 kV, 25 μF. Set the pulse controller to 200 ohms
	**Place the cuvette into the sample chamber		**Place the cuvette into the sample chamber
Line 124:		Line 118:
	**Remove the cuvette. Immediately add 1 mL LB medium and transfer to a sterile culture tube		**Remove the cuvette. Immediately add 1 mL LB medium and transfer to a sterile culture tube
	**Incubate 60-120 min with moderate shaking at 37{{c}}		**Incubate 60-120 min with moderate shaking at 37{{c}}
-	**Plate aliquots of the transformation culture on LB plates supplemented with chloramphenicol (10 {{ug}}/mL, 20 {{ug}}/mL)	+	**Plate aliquots of the transformation culture on LB plates supplemented with chloramphenicol (10 {{ug}}/mL, 25 {{ug}}/mL)

	==Notes==		==Notes==
Line 135:		Line 129:


-	*pKD3 ~~CmR~~ sequence (1033 bases)	+	*pKD3 Cat sequence (1033 bases)
	<span style="font-family:Courier,monospace;">		<span style="font-family:Courier,monospace;">
	{{blue\|GTGTAGGCTGGAGCTGCTTC}}GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCTTTAAATGGCGCGCCTTACGCCCCGCCC		{{blue\|GTGTAGGCTGGAGCTGCTTC}}GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCTTTAAATGGCGCGCCTTACGCCCCGCCC
Line 175:		Line 169:
	***{{red\|GGTTGTACGCGTGGGGTAGGGGTTA}} (25 bases)		***{{red\|GGTTGTACGCGTGGGGTAGGGGTTA}} (25 bases)

-	*Figure out the sequence and size of what you should expect if everything works. In this case, it's ~~CmR~~ inserted into endA flanking region''' (1132 bases total)	+	*Figure out the sequence and size of what you should expect if everything works. In this case, it's Cat inserted into endA flanking region''' (1132 bases total)
	<span style="font-family:Courier,monospace;">		<span style="font-family:Courier,monospace;">
	{{orange\|CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTG}}{{blue\|GTGTAGGCTGGAGCTGCTTC}}GAAGTTCCTATACTTTCTAGAGAATAGGAACTTC		{{orange\|CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTG}}{{blue\|GTGTAGGCTGGAGCTGCTTC}}GAAGTTCCTATACTTTCTAGAGAATAGGAACTTC

ShawnDouglas: /* Procedure */

2007-05-04T03:32:23Z

Procedure

←Older revision		Revision as of 03:32, 4 May 2007
Line 65:		Line 65:
	***Incubate at 30{{c}} overnight		***Incubate at 30{{c}} overnight
	**PCR endA-CmR from pKD3 and verify on gel		**PCR endA-CmR from pKD3 and verify on gel
-	**PCR program: 95{{c}} 7min → 20[94{{c}} 15s → 50{{c}} 30s → 72{{c}} 90s]	+	**PCR program: 95{{c}} 7min → 35[94{{c}} 15s → 50{{c}} 30s → 72{{c}} 90s]
	::{\| {{table}}		::{\| {{table}}
	\| align="center" style="background:#f0f0f0;"\|'''Contents'''		\| align="center" style="background:#f0f0f0;"\|'''Contents'''

ShawnDouglas: /* Procedure */

2007-05-04T03:29:10Z

Procedure

←Older revision		Revision as of 03:29, 4 May 2007
Line 56:		Line 56:
	**Aliquot 400 {{ul}} each into five 1.5 mL tubes		**Aliquot 400 {{ul}} each into five 1.5 mL tubes
	**Store in -80{{c}} freezer.		**Store in -80{{c}} freezer.
-	**Transform strain with pKD46 and grow on LB-amp~~-kan~~ plate at 30{{c}}	+	**Transform strain with pKD46 and grow on LB-amp plate at 30{{c}}
	***Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA		***Prepare four tubes with 0, 1 ng, 10 ng, and 100 ng pKD46 plasmid DNA
	***Add 100 {{ul}} of competent cell mix to each tube		***Add 100 {{ul}} of competent cell mix to each tube

ShawnDouglas: /* Procedure */

2007-05-04T03:27:31Z

Procedure

←Older revision		Revision as of 03:27, 4 May 2007
Line 16:		Line 16:

	==Procedure==		==Procedure==
-	*'''~~Geneeral~~ outline'''	+	*'''General outline'''
	**Grow up pKD46, pKD3, and pCP20 in current host strains		**Grow up pKD46, pKD3, and pCP20 in current host strains
	**Perform minipreps to extract plasmids		**Perform minipreps to extract plasmids

Reshma P. Shetty at 17:43, 20 April 2007

2007-04-20T17:43:58Z

←Older revision		Revision as of 17:43, 20 April 2007
Line 210:		Line 210:
	*[[User:ShawnDouglas\|Shawn Douglas]] — posted original protocol, performed once in August 2006.		*[[User:ShawnDouglas\|Shawn Douglas]] — posted original protocol, performed once in August 2006.

-	[[Category:Protocol]]	+	[[Category:Protocol]] [[Category:Escherichia coli]]

←Older revision		Revision as of 20:32, 30 September 2007
Line 173:		Line 173:
	{{orange\|CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTG}}{{blue\|GTGTAGGCTGGAGCTGCTTC}}GAAGTTCCTATACTTTCTAGAGAATAGGAACTTC		{{orange\|CCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGGAGTAAGTG}}{{blue\|GTGTAGGCTGGAGCTGCTTC}}GAAGTTCCTATACTTTCTAGAGAATAGGAACTTC
	GGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGCATGGAAGCCATCACAAA		GGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGCATGGAAGCCATCACAAA
-	~~CGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGC~~	+	CGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCC
-	~~CACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAAC~~	+	ACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACA
-	~~ACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAA~~	+	CGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAAC
-	~~CAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGG~~	+	AAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGA
-	~~ATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAA~~	+	TAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAA
-	~~ATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAA~~	+	ATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAA
-	~~TACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTAT~~	+	ATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTA
-	~~CAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGG~~	+	TCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTAGGCGCGCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAG
-	~~AACTAAGGAGGATATTCATAT~~{{purple\|GGACCATGGCTAATTCCCAT}}{{red\|CCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC}}	+	GAACTAAGGAGGATATTCATAT{{purple\|GGACCATGGCTAATTCCCAT}}{{red\|CCTACACTAGCGGGATTCTTTTTGTTAACCCCTACCCCACGCGTACAACC}}
	</span>		</span>
-
-
-

	==References==		==References==