Registry/Measurement kit/Notebook/2007-6-19: Difference between revisions

Revision as of 23:16, 19 June 2007

Growth only on the Kan plate with Device B (GFP rbs tester, R0040 + I13401), doing a verification PCR on 8 of these colonies.
- Spun down cultures with other devices, plating them for overnight.
See Endy:Colony_PCR
- note: 72° is the extension step. taq is in shared polymerase box in first room

All but 2 had the right size. (will upload image soon) Choosing colony #8 for sequencing tomorrow.
- note: ladder in Controls box in -20, loading buffer in -4.
Made overnight culture of colony 8.

E0240_F -- CTTAGTAG CAATTG TCACACAGGAAAGTACTAGATGCG
E0240_R -- TCAGCCAT ATGCAT TATAAACGCAGAAAGGCCCAC
- in Vector NTI, go to analysis -> oligo analysis

Bold is tail, italics is restriction site.

@@ Line 1: / Line 1: @@
-*Growth only on the Kan plate - doing a colony PCR to check.
+==Colony PCR==
-**note: 72° is the extension step.
+*Growth only on the Kan plate with Device B (GFP rbs tester, R0040 + I13401), doing a verification PCR on 8 of these colonies.
+**Spun down cultures with other devices, plating them for overnight.
+*See [[Endy:Colony_PCR]]
+**note: 72° is the extension step. taq is in shared polymerase box in first room
+==Prepared chemically competent cells==
+*see [[Preparing_chemically_competent_cells|protocol]]
+==Analytic Gel of Colony PCR==
+*All but 2 had the right size. (will upload image soon) Choosing colony #8 for sequencing tomorrow.
+**note: ladder in Controls box in -20, loading buffer in -4.
+*Made overnight culture of colony 8.
 ==Ordered primers for E0240==
 *E0240_F -- '''CTTAGTAG ''CAATTG''''' TCACACAGGAAAGTACTAGATGCG
 *E0240_R -- '''TCAGCCAT ''ATGCAT''''' TATAAACGCAGAAAGGCCCAC
+**in Vector NTI, go to analysis -> oligo analysis
 Bold is tail, italics is restriction site.