Registry/Measurement kit/Notebook/2007-6-19: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
|||
Line 7: | Line 7: | ||
==Prepared chemically competent cells== | ==Prepared chemically competent cells== | ||
*see [[Preparing_chemically_competent_cells|protocol]] | *see [[Preparing_chemically_competent_cells|protocol]] | ||
*made stocks of MG1655 and top10 | |||
**note: need more TSS buffer! | |||
==Analytic Gel of Colony PCR== | ==Analytic Gel of Colony PCR== |
Latest revision as of 23:20, 19 June 2007
Colony PCR
- Growth only on the Kan plate with Device B (GFP rbs tester, R0040 + I13401), doing a verification PCR on 8 of these colonies.
- Spun down cultures with other devices, plating them for overnight.
- See Endy:Colony_PCR
- note: 72° is the extension step. taq is in shared polymerase box in first room
Prepared chemically competent cells
- see protocol
- made stocks of MG1655 and top10
- note: need more TSS buffer!
Analytic Gel of Colony PCR
- All but 2 had the right size. (will upload image soon) Choosing colony #8 for sequencing tomorrow.
- note: ladder in Controls box in -20, loading buffer in -4.
- Made overnight culture of colony 8.
Ordered primers for E0240
- E0240_F -- CTTAGTAG CAATTG TCACACAGGAAAGTACTAGATGCG
- E0240_R -- TCAGCCAT ATGCAT TATAAACGCAGAAAGGCCCAC
- in Vector NTI, go to analysis -> oligo analysis
Bold is tail, italics is restriction site.