Registry/Measurement kit/Notebook/2007-7-31

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search

Nishant M. Bhat (Talk | contribs)
(New page: ==E0240== *Noticed that during the scarring PCR, a point substitution was made. *Decided to try a site-directed mutagenesis on the biobricked product. *Ordered two pairs of primers: **...)
Next diff →

Revision as of 16:19, 31 July 2007

E0240

  • Noticed that during the scarring PCR, a point substitution was made.
  • Decided to try a site-directed mutagenesis on the biobricked product.
  • Ordered two pairs of primers:
    • First pair - mutation in the ends of the primers:
      • CGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGC, E0240_mut_E_F (78.8)
      • CTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGATTGTGTGGACAGG, E0240_mut_E_R (79.7)
    • Second pair - mutation in the middle of the primers:
      • CCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTG, E0240_mut_M_F (80)
      • ACCATGTGGTCTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGATTG, E0240_mut_M_R (79.3)

I2057

  • Re-transformed both versions with ccdB into DB3.1

Misc

  • Made chemically competent DB3.1 cells.
Personal tools