Richard Lab:Bio-Brick Formats

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
m (Biobrick Standard)
(Biobrick Standard)
Line 9: Line 9:
This standard uses the typical biobrick assembly enzymes [EcoRI (GAATTC), XbaI (TCTAGA), SpeI (ACTAGT), and PstI (CTGCAG)] as well as NotI sites (GCGGCCGC) flanking the part. There is a slightly different prefix for protein coding parts to put the start codon in a better spot in relation to the RBS.
This standard uses the typical biobrick assembly enzymes [EcoRI (GAATTC), XbaI (TCTAGA), SpeI (ACTAGT), and PstI (CTGCAG)] as well as NotI sites (GCGGCCGC) flanking the part. There is a slightly different prefix for protein coding parts to put the start codon in a better spot in relation to the RBS.
::*The EcoRI and XbaI sites are in caps while the NotI site is in bold.  
::*The EcoRI and XbaI sites are in caps while the NotI site is in bold.  
*Protein Coding Prefix
*Protein Coding Prefix

Revision as of 15:23, 24 January 2011

Back to Protocols



In general the Richard Lab uses the standard Bio-Brick format. However occasionally this format is incompatible with our goals (e.g. making protein fusions) or is unnecessarilly cumbersome (e.g. PCR overlap extension).


Biobrick Standard

This standard uses the typical biobrick assembly enzymes [EcoRI (GAATTC), XbaI (TCTAGA), SpeI (ACTAGT), and PstI (CTGCAG)] as well as NotI sites (GCGGCCGC) flanking the part. There is a slightly different prefix for protein coding parts to put the start codon in a better spot in relation to the RBS.

  • Prefix
  • GAATTCgcggccgctTCTAGAg
  • The EcoRI and XbaI sites are in caps while the NotI site is in bold.
  • Protein Coding Prefix
  • GAATTCgcggccgctTCTAG
  • using this prefix the first base of the start codon (i.e. the "A" in "ATG") will complete the XbaI site.
  • Suffix
  • tactagtagcggccgctgcag

Short Biobrick

Protein Fusions

Back to Protocols

Personal tools